Mutagenetix > Incidental Mutation

Incidental Mutation 'PIT4585001:Slc5a8'

556616

Institutional Source

Beutler Lab

Gene Symbol

Slc5a8

Ensembl Gene

ENSMUSG00000020062

Gene Name

solute carrier family 5 (iodide transporter), member 8

Synonyms

SMCT

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

PIT4585001 (G1)

Quality Score

202.009

Status

Not validated

Chromosome

Chromosomal Location

88885992-88929515 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 88886503 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Arginine at position 66 (M66R)

Ref Sequence

ENSEMBL: ENSMUSP00000020255 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020255]

AlphaFold

Q8BYF6

Predicted Effect

probably damaging
Transcript: ENSMUST00000020255
AA Change: M66R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000020255
Gene: ENSMUSG00000020062
AA Change: M66R

Domain	Start	End	E-Value	Type
transmembrane domain	10	32	N/A	INTRINSIC
Pfam:SSF	45	449	2.6e-38	PFAM
low complexity region	462	478	N/A	INTRINSIC
transmembrane domain	519	541	N/A	INTRINSIC

Coding Region Coverage

1x: 93.6%
3x: 91.2%
10x: 86.5%
20x: 76.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SLC5A8 has been shown to transport iodide by a passive mechanism (Rodriguez et al., 2002 [PubMed 12107270]) and monocarboxylates and short-chain fatty acids by a sodium-coupled mechanism (Gopal et al., 2004 [PubMed 15322102]). In kidney, SLC5A8 functions as a high-affinity sodium-coupled lactate transporter involved in reabsorption of lactate and maintenance of blood lactate levels (Thangaraju et al., 2006 [PubMed 16873376]).[supplied by OMIM, Dec 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit increased lactate concentrations in the saliva and urine. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aurka	T	C	2: 172,357,197	M318V	probably benign	Het
Cacna2d1	T	A	5: 16,326,344	D560E	probably damaging	Het
Ccdc148	T	A	2: 58,982,976	T202S	probably benign	Het
Ccdc155	C	T	7: 45,200,271	G76D	probably benign	Het
Cdc42bpb	T	C	12: 111,304,978	D1149G	probably damaging	Het
Clasp1	T	A	1: 118,462,555	N156K	probably damaging	Het
Cox18	G	A	5: 90,217,575	T255I	possibly damaging	Het
Cse1l	A	G	2: 166,941,474	T783A	probably damaging	Het
Dnajc16	T	C	4: 141,764,685	Y609C	probably damaging	Het
Doc2g	A	G	19: 4,006,630	T339A	probably benign	Het
Eif5a	T	C	11: 69,918,070		probably benign	Het
Epha3	A	G	16: 63,566,577		probably null	Het
Esco1	A	T	18: 10,594,355	C310*	probably null	Het
Fam208b	G	A	13: 3,574,979	A1657V	possibly damaging	Het
Fam222a	A	G	5: 114,611,040	Y99C	probably damaging	Het
Fzd2	T	C	11: 102,605,747	L339P	probably damaging	Het
Gfral	A	T	9: 76,197,294	N145K	probably damaging	Het
Gga1	T	A	15: 78,893,790	N618K	probably benign	Het
Gpatch3	T	A	4: 133,583,086	H447Q	probably damaging	Het
Gpn1	A	T	5: 31,509,403	R346*	probably null	Het
Gsg1	T	C	6: 135,237,560	E317G	probably benign	Het
Gsk3b	A	G	16: 38,184,454	N129S	probably damaging	Het
Hmg20b	G	T	10: 81,348,955	D94E	possibly damaging	Het
Klhdc9	T	A	1: 171,359,818	H204L	possibly damaging	Het
Klhl24	A	G	16: 20,106,888	I55M	probably benign	Het
Kmt2c	T	C	5: 25,315,106	D2002G	probably benign	Het
Lama4	A	G	10: 39,074,746	N1015S	probably damaging	Het
Lpp	T	C	16: 24,761,947	C263R	probably benign	Het
Lrp1b	T	C	2: 41,269,204	I1689V		Het
Mipep	C	A	14: 60,784,835	Q50K	probably benign	Het
Mx1	T	C	16: 97,456,254	D101G	probably benign	Het
Nabp2	C	G	10: 128,408,807	E37Q	possibly damaging	Het
Nme6	A	G	9: 109,842,036	I115V	possibly damaging	Het
Nup93	A	T	8: 94,243,727	T85S	probably benign	Het
Oit3	T	A	10: 59,431,013	I224F	possibly damaging	Het
Parp14	T	C	16: 35,858,605	K331R	probably benign	Het
Pls1	T	A	9: 95,761,390	T519S	probably benign	Het
Rcn3	A	G	7: 45,086,694	F197L	probably benign	Het
Rnf213	C	T	11: 119,458,392	T3773I		Het
Rprd1b	A	T	2: 158,047,957	I153L	probably benign	Het
Scel	A	G	14: 103,592,368	D462G	possibly damaging	Het
Sh3bp1	C	T	15: 78,910,076	S548L	possibly damaging	Het
Sim1	T	A	10: 50,984,188	Y715*	probably null	Het
Slc18a2	A	T	19: 59,293,861	Q500L	possibly damaging	Het
Slco1a6	T	C	6: 142,109,520	T233A	probably damaging	Het
Smu1	T	C	4: 40,739,623	T396A	probably benign	Het
Tas2r104	T	C	6: 131,685,558	T63A	possibly damaging	Het
Top2a	C	T	11: 99,001,373	A1088T	probably benign	Het
Ucp1	T	C	8: 83,293,948	F129S	probably damaging	Het
Unc13b	T	A	4: 43,091,298	D41E	probably benign	Het
Usp10	T	G	8: 119,954,892	V696G	probably benign	Het
Xylt2	C	T	11: 94,666,240	V745M	probably damaging	Het
Zbtb49	A	T	5: 38,216,476	N41K	probably damaging	Het
Zfp109	T	A	7: 24,229,354	D218V	probably benign	Het
Zfp420	G	A	7: 29,876,005	R550Q	probably benign	Het

Other mutations in Slc5a8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00507:Slc5a8	APN	10	88908040	missense	possibly damaging	0.91
IGL00902:Slc5a8	APN	10	88919461	missense	probably benign	0.03
IGL00960:Slc5a8	APN	10	88921765	missense	probably benign	0.21
IGL01109:Slc5a8	APN	10	88906392	missense	possibly damaging	0.95
IGL01365:Slc5a8	APN	10	88892097	splice site	probably benign
IGL01418:Slc5a8	APN	10	88905033	missense	probably damaging	1.00
IGL01823:Slc5a8	APN	10	88919472	nonsense	probably null
IGL02116:Slc5a8	APN	10	88919500	missense	probably benign
IGL03109:Slc5a8	APN	10	88906416	splice site	probably benign
R0010:Slc5a8	UTSW	10	88886590	missense	probably benign	0.03
R0418:Slc5a8	UTSW	10	88886558	missense	probably benign	0.01
R1233:Slc5a8	UTSW	10	88918442	missense	probably damaging	1.00
R1656:Slc5a8	UTSW	10	88925786	critical splice donor site	probably null
R1769:Slc5a8	UTSW	10	88919464	missense	probably benign
R1769:Slc5a8	UTSW	10	88919466	nonsense	probably null
R2870:Slc5a8	UTSW	10	88904963	missense	probably benign	0.01
R2870:Slc5a8	UTSW	10	88904963	missense	probably benign	0.01
R2873:Slc5a8	UTSW	10	88904963	missense	probably benign	0.01
R3883:Slc5a8	UTSW	10	88902463	missense	possibly damaging	0.89
R4207:Slc5a8	UTSW	10	88911413	missense	probably damaging	1.00
R4731:Slc5a8	UTSW	10	88925787	critical splice donor site	probably null
R4880:Slc5a8	UTSW	10	88892024	missense	probably damaging	1.00
R4969:Slc5a8	UTSW	10	88904912	splice site	probably null
R4998:Slc5a8	UTSW	10	88908057	critical splice donor site	probably null
R5009:Slc5a8	UTSW	10	88909654	missense	probably benign	0.07
R5068:Slc5a8	UTSW	10	88886598	missense	possibly damaging	0.82
R5069:Slc5a8	UTSW	10	88886598	missense	possibly damaging	0.82
R5070:Slc5a8	UTSW	10	88886598	missense	possibly damaging	0.82
R5130:Slc5a8	UTSW	10	88926215	missense	probably benign
R5141:Slc5a8	UTSW	10	88919560	critical splice donor site	probably null
R5252:Slc5a8	UTSW	10	88906347	missense	probably damaging	1.00
R5659:Slc5a8	UTSW	10	88919428	missense	possibly damaging	0.89
R5660:Slc5a8	UTSW	10	88919428	missense	possibly damaging	0.89
R5661:Slc5a8	UTSW	10	88919428	missense	possibly damaging	0.89
R6039:Slc5a8	UTSW	10	88886574	missense	probably benign	0.00
R6039:Slc5a8	UTSW	10	88886574	missense	probably benign	0.00
R6378:Slc5a8	UTSW	10	88905054	missense	probably damaging	1.00
R7214:Slc5a8	UTSW	10	88919502	missense	probably benign
R7255:Slc5a8	UTSW	10	88909631	missense	probably damaging	1.00
R7526:Slc5a8	UTSW	10	88902491	missense	probably damaging	1.00
R7604:Slc5a8	UTSW	10	88904960	missense	possibly damaging	0.78
R7688:Slc5a8	UTSW	10	88921699	missense	probably damaging	1.00
R7869:Slc5a8	UTSW	10	88921705	missense	probably benign	0.15
R8219:Slc5a8	UTSW	10	88921699	missense	probably damaging	1.00
R8474:Slc5a8	UTSW	10	88921690	missense	possibly damaging	0.69
R8937:Slc5a8	UTSW	10	88905023	missense	probably damaging	1.00
R8960:Slc5a8	UTSW	10	88886173	start gained	probably benign
R9000:Slc5a8	UTSW	10	88926227	missense	probably benign	0.00
R9000:Slc5a8	UTSW	10	88926228	missense	probably benign	0.13
R9792:Slc5a8	UTSW	10	88921729	missense	possibly damaging	0.55
R9795:Slc5a8	UTSW	10	88921729	missense	possibly damaging	0.55
Z1177:Slc5a8	UTSW	10	88909613	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCTAAAACCACCTGTGCTGC -3'
(R):5'- GCCTGAAAATGCAAGCAAGC -3'

Sequencing Primer
(F):5'- CGGGACATCGGCAGTTTTG -3'
(R):5'- TGAAAATGCAAGCAAGCCTCCC -3'

Posted On

2019-06-07