Incidental Mutation 'PIT4585001:Nabp2'
ID556617
Institutional Source Beutler Lab
Gene Symbol Nabp2
Ensembl Gene ENSMUSG00000025374
Gene Namenucleic acid binding protein 2
SynonymsNabp2, 2610036N15Rik, Obfc2b
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #PIT4585001 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location128401395-128411492 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 128408807 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glutamine at position 37 (E37Q)
Ref Sequence ENSEMBL: ENSMUSP00000128634 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026439] [ENSMUST00000096386] [ENSMUST00000164199] [ENSMUST00000164664] [ENSMUST00000166608] [ENSMUST00000171342] [ENSMUST00000171370] [ENSMUST00000171494] [ENSMUST00000172238] [ENSMUST00000172348] [ENSMUST00000217826]
Predicted Effect possibly damaging
Transcript: ENSMUST00000026439
AA Change: E37Q

PolyPhen 2 Score 0.638 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000026439
Gene: ENSMUSG00000025374
AA Change: E37Q

DomainStartEndE-ValueType
Pfam:tRNA_anti-codon 23 105 1.7e-9 PFAM
low complexity region 131 148 N/A INTRINSIC
low complexity region 161 178 N/A INTRINSIC
low complexity region 185 203 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000096386
SMART Domains Protein: ENSMUSP00000100869
Gene: ENSMUSG00000025373

DomainStartEndE-ValueType
RING 18 56 1.54e-5 SMART
Pfam:USP8_interact 137 315 5.1e-96 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000164199
AA Change: E37Q

PolyPhen 2 Score 0.638 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000128634
Gene: ENSMUSG00000025374
AA Change: E37Q

DomainStartEndE-ValueType
Pfam:tRNA_anti-codon 23 105 1.7e-9 PFAM
low complexity region 131 148 N/A INTRINSIC
low complexity region 161 178 N/A INTRINSIC
low complexity region 185 203 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000164664
AA Change: E37Q

PolyPhen 2 Score 0.638 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000127605
Gene: ENSMUSG00000025374
AA Change: E37Q

DomainStartEndE-ValueType
Pfam:tRNA_anti-codon 22 105 5.8e-10 PFAM
low complexity region 131 148 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166577
SMART Domains Protein: ENSMUSP00000128794
Gene: ENSMUSG00000014498

DomainStartEndE-ValueType
ANK 18 48 5.09e-2 SMART
ANK 52 81 2.54e-2 SMART
ANK 88 117 1.34e-1 SMART
Blast:ANK 121 148 3e-9 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000166608
AA Change: E53Q

PolyPhen 2 Score 0.779 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000131171
Gene: ENSMUSG00000025374
AA Change: E53Q

DomainStartEndE-ValueType
Pfam:tRNA_anti-codon 39 120 4.2e-9 PFAM
low complexity region 147 164 N/A INTRINSIC
low complexity region 177 194 N/A INTRINSIC
low complexity region 201 219 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171342
SMART Domains Protein: ENSMUSP00000132751
Gene: ENSMUSG00000025373

DomainStartEndE-ValueType
RING 18 56 1.54e-5 SMART
Pfam:USP8_interact 137 315 2.3e-91 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000171370
AA Change: E37Q

PolyPhen 2 Score 0.638 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000127436
Gene: ENSMUSG00000025374
AA Change: E37Q

DomainStartEndE-ValueType
PDB:4OWX|B 1 56 3e-35 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000171494
AA Change: E37Q

PolyPhen 2 Score 0.638 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000126842
Gene: ENSMUSG00000025374
AA Change: E37Q

DomainStartEndE-ValueType
PDB:4OWX|B 1 65 5e-41 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000172238
Predicted Effect possibly damaging
Transcript: ENSMUST00000172348
AA Change: E37Q

PolyPhen 2 Score 0.638 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000127015
Gene: ENSMUSG00000025374
AA Change: E37Q

DomainStartEndE-ValueType
Pfam:tRNA_anti-codon 22 105 6.1e-10 PFAM
low complexity region 131 148 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000217826
Coding Region Coverage
  • 1x: 93.6%
  • 3x: 91.2%
  • 10x: 86.5%
  • 20x: 76.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Single-stranded DNA (ssDNA)-binding proteins, such as OBFC2B, are ubiquitous and essential for a variety of DNA metabolic processes, including replication, recombination, and detection and repair of damage (Richard et al., 2008 [PubMed 18449195]).[supplied by OMIM, Jun 2008]
PHENOTYPE: Mice homozygous for a targeted allele exhibit complete perinatal lethality, fetal growth retardation, abnormal limb development, abnormal cranium morphology, small rib cage, thin and porous bones, cleft palate, oligodactyly, increased apoptosis at E12.5 and increased genomic instability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aurka T C 2: 172,357,197 M318V probably benign Het
Cacna2d1 T A 5: 16,326,344 D560E probably damaging Het
Ccdc148 T A 2: 58,982,976 T202S probably benign Het
Ccdc155 C T 7: 45,200,271 G76D probably benign Het
Cdc42bpb T C 12: 111,304,978 D1149G probably damaging Het
Clasp1 T A 1: 118,462,555 N156K probably damaging Het
Cox18 G A 5: 90,217,575 T255I possibly damaging Het
Cse1l A G 2: 166,941,474 T783A probably damaging Het
Dnajc16 T C 4: 141,764,685 Y609C probably damaging Het
Doc2g A G 19: 4,006,630 T339A probably benign Het
Eif5a T C 11: 69,918,070 probably benign Het
Epha3 A G 16: 63,566,577 probably null Het
Esco1 A T 18: 10,594,355 C310* probably null Het
Fam208b G A 13: 3,574,979 A1657V possibly damaging Het
Fam222a A G 5: 114,611,040 Y99C probably damaging Het
Fzd2 T C 11: 102,605,747 L339P probably damaging Het
Gfral A T 9: 76,197,294 N145K probably damaging Het
Gga1 T A 15: 78,893,790 N618K probably benign Het
Gpatch3 T A 4: 133,583,086 H447Q probably damaging Het
Gpn1 A T 5: 31,509,403 R346* probably null Het
Gsg1 T C 6: 135,237,560 E317G probably benign Het
Gsk3b A G 16: 38,184,454 N129S probably damaging Het
Hmg20b G T 10: 81,348,955 D94E possibly damaging Het
Klhdc9 T A 1: 171,359,818 H204L possibly damaging Het
Klhl24 A G 16: 20,106,888 I55M probably benign Het
Kmt2c T C 5: 25,315,106 D2002G probably benign Het
Lama4 A G 10: 39,074,746 N1015S probably damaging Het
Lpp T C 16: 24,761,947 C263R probably benign Het
Lrp1b T C 2: 41,269,204 I1689V Het
Mipep C A 14: 60,784,835 Q50K probably benign Het
Mx1 T C 16: 97,456,254 D101G probably benign Het
Nme6 A G 9: 109,842,036 I115V possibly damaging Het
Nup93 A T 8: 94,243,727 T85S probably benign Het
Oit3 T A 10: 59,431,013 I224F possibly damaging Het
Parp14 T C 16: 35,858,605 K331R probably benign Het
Pls1 T A 9: 95,761,390 T519S probably benign Het
Rcn3 A G 7: 45,086,694 F197L probably benign Het
Rnf213 C T 11: 119,458,392 T3773I Het
Rprd1b A T 2: 158,047,957 I153L probably benign Het
Scel A G 14: 103,592,368 D462G possibly damaging Het
Sh3bp1 C T 15: 78,910,076 S548L possibly damaging Het
Sim1 T A 10: 50,984,188 Y715* probably null Het
Slc18a2 A T 19: 59,293,861 Q500L possibly damaging Het
Slc5a8 T G 10: 88,886,503 M66R probably damaging Het
Slco1a6 T C 6: 142,109,520 T233A probably damaging Het
Smu1 T C 4: 40,739,623 T396A probably benign Het
Tas2r104 T C 6: 131,685,558 T63A possibly damaging Het
Top2a C T 11: 99,001,373 A1088T probably benign Het
Ucp1 T C 8: 83,293,948 F129S probably damaging Het
Unc13b T A 4: 43,091,298 D41E probably benign Het
Usp10 T G 8: 119,954,892 V696G probably benign Het
Xylt2 C T 11: 94,666,240 V745M probably damaging Het
Zbtb49 A T 5: 38,216,476 N41K probably damaging Het
Zfp109 T A 7: 24,229,354 D218V probably benign Het
Zfp420 G A 7: 29,876,005 R550Q probably benign Het
Other mutations in Nabp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01305:Nabp2 APN 10 128408762 missense probably damaging 0.98
IGL02397:Nabp2 APN 10 128408323 missense possibly damaging 0.46
ANU22:Nabp2 UTSW 10 128408762 missense probably damaging 0.98
R1928:Nabp2 UTSW 10 128409313 missense possibly damaging 0.89
R4909:Nabp2 UTSW 10 128401687 unclassified probably benign
R5031:Nabp2 UTSW 10 128409628 unclassified probably benign
R5724:Nabp2 UTSW 10 128409686 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- AAGCAGGATTCGGTCTTCAG -3'
(R):5'- TCTCTCCATGGTGCTGGATC -3'

Sequencing Primer
(F):5'- CAGGATTCGGTCTTCAGAAAAGTTG -3'
(R):5'- ATGGTGCTGGATCTCCACTAC -3'
Posted On2019-06-07