Incidental Mutation 'PIT4585001:Fzd2'
ID556621
Institutional Source Beutler Lab
Gene Symbol Fzd2
Ensembl Gene ENSMUSG00000050288
Gene Namefrizzled class receptor 2
SynonymsMfz10a, Fz10, Mfz10
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.379) question?
Stock #PIT4585001 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location102604396-102608058 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 102605747 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 339 (L339P)
Ref Sequence ENSEMBL: ENSMUSP00000091463 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057893]
Predicted Effect probably damaging
Transcript: ENSMUST00000057893
AA Change: L339P

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000091463
Gene: ENSMUSG00000050288
AA Change: L339P

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
FRI 43 160 7.47e-74 SMART
low complexity region 176 195 N/A INTRINSIC
Frizzled 239 563 3.32e-218 SMART
Coding Region Coverage
  • 1x: 93.6%
  • 3x: 91.2%
  • 10x: 86.5%
  • 20x: 76.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This intronless gene is a member of the frizzled gene family. Members of this family encode seven-transmembrane domain proteins that are receptors for the wingless type MMTV integration site family of signaling proteins. This gene encodes a protein that is coupled to the beta-catenin canonical signaling pathway. Competition between the wingless-type MMTV integration site family, member 3A and wingless-type MMTV integration site family, member 5A gene products for binding of this protein is thought to regulate the beta-catenin-dependent and -independent pathways. [provided by RefSeq, Dec 2010]
PHENOTYPE: About 50% of mice homozygous for a reporter allele display a cleft palate and die as neonates; the remaining 50% survive exhibiting a variable degree of postnatal runting and reduced olfactory sensitivity to various odorants. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aurka T C 2: 172,357,197 M318V probably benign Het
Cacna2d1 T A 5: 16,326,344 D560E probably damaging Het
Ccdc148 T A 2: 58,982,976 T202S probably benign Het
Ccdc155 C T 7: 45,200,271 G76D probably benign Het
Cdc42bpb T C 12: 111,304,978 D1149G probably damaging Het
Clasp1 T A 1: 118,462,555 N156K probably damaging Het
Cox18 G A 5: 90,217,575 T255I possibly damaging Het
Cse1l A G 2: 166,941,474 T783A probably damaging Het
Dnajc16 T C 4: 141,764,685 Y609C probably damaging Het
Doc2g A G 19: 4,006,630 T339A probably benign Het
Eif5a T C 11: 69,918,070 probably benign Het
Epha3 A G 16: 63,566,577 probably null Het
Esco1 A T 18: 10,594,355 C310* probably null Het
Fam208b G A 13: 3,574,979 A1657V possibly damaging Het
Fam222a A G 5: 114,611,040 Y99C probably damaging Het
Gfral A T 9: 76,197,294 N145K probably damaging Het
Gga1 T A 15: 78,893,790 N618K probably benign Het
Gpatch3 T A 4: 133,583,086 H447Q probably damaging Het
Gpn1 A T 5: 31,509,403 R346* probably null Het
Gsg1 T C 6: 135,237,560 E317G probably benign Het
Gsk3b A G 16: 38,184,454 N129S probably damaging Het
Hmg20b G T 10: 81,348,955 D94E possibly damaging Het
Klhdc9 T A 1: 171,359,818 H204L possibly damaging Het
Klhl24 A G 16: 20,106,888 I55M probably benign Het
Kmt2c T C 5: 25,315,106 D2002G probably benign Het
Lama4 A G 10: 39,074,746 N1015S probably damaging Het
Lpp T C 16: 24,761,947 C263R probably benign Het
Lrp1b T C 2: 41,269,204 I1689V Het
Mipep C A 14: 60,784,835 Q50K probably benign Het
Mx1 T C 16: 97,456,254 D101G probably benign Het
Nabp2 C G 10: 128,408,807 E37Q possibly damaging Het
Nme6 A G 9: 109,842,036 I115V possibly damaging Het
Nup93 A T 8: 94,243,727 T85S probably benign Het
Oit3 T A 10: 59,431,013 I224F possibly damaging Het
Parp14 T C 16: 35,858,605 K331R probably benign Het
Pls1 T A 9: 95,761,390 T519S probably benign Het
Rcn3 A G 7: 45,086,694 F197L probably benign Het
Rnf213 C T 11: 119,458,392 T3773I Het
Rprd1b A T 2: 158,047,957 I153L probably benign Het
Scel A G 14: 103,592,368 D462G possibly damaging Het
Sh3bp1 C T 15: 78,910,076 S548L possibly damaging Het
Sim1 T A 10: 50,984,188 Y715* probably null Het
Slc18a2 A T 19: 59,293,861 Q500L possibly damaging Het
Slc5a8 T G 10: 88,886,503 M66R probably damaging Het
Slco1a6 T C 6: 142,109,520 T233A probably damaging Het
Smu1 T C 4: 40,739,623 T396A probably benign Het
Tas2r104 T C 6: 131,685,558 T63A possibly damaging Het
Top2a C T 11: 99,001,373 A1088T probably benign Het
Ucp1 T C 8: 83,293,948 F129S probably damaging Het
Unc13b T A 4: 43,091,298 D41E probably benign Het
Usp10 T G 8: 119,954,892 V696G probably benign Het
Xylt2 C T 11: 94,666,240 V745M probably damaging Het
Zbtb49 A T 5: 38,216,476 N41K probably damaging Het
Zfp109 T A 7: 24,229,354 D218V probably benign Het
Zfp420 G A 7: 29,876,005 R550Q probably benign Het
Other mutations in Fzd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01667:Fzd2 APN 11 102605782 missense possibly damaging 0.94
IGL02034:Fzd2 APN 11 102604904 missense probably damaging 1.00
IGL02035:Fzd2 APN 11 102606444 makesense probably null
R0201:Fzd2 UTSW 11 102606122 missense probably damaging 1.00
R1146:Fzd2 UTSW 11 102605380 missense possibly damaging 0.76
R1146:Fzd2 UTSW 11 102605380 missense possibly damaging 0.76
R1530:Fzd2 UTSW 11 102605308 missense probably benign 0.00
R1589:Fzd2 UTSW 11 102606328 missense probably benign 0.06
R1676:Fzd2 UTSW 11 102605881 missense probably damaging 1.00
R2057:Fzd2 UTSW 11 102605933 missense probably damaging 1.00
R2219:Fzd2 UTSW 11 102605423 missense probably benign 0.01
R2410:Fzd2 UTSW 11 102605627 missense possibly damaging 0.71
R5058:Fzd2 UTSW 11 102604807 missense probably damaging 0.99
R5296:Fzd2 UTSW 11 102606155 missense probably damaging 0.96
R5580:Fzd2 UTSW 11 102605839 missense probably damaging 0.99
R5788:Fzd2 UTSW 11 102605467 missense probably benign 0.03
R6104:Fzd2 UTSW 11 102606335 missense probably damaging 1.00
R6452:Fzd2 UTSW 11 102604985 missense probably damaging 1.00
R7454:Fzd2 UTSW 11 102605129 missense probably damaging 1.00
R7774:Fzd2 UTSW 11 102605488 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- TATTTAGTGGACATGCAGCGATTTC -3'
(R):5'- TATTGAGGCCCACGAAGCAC -3'

Sequencing Primer
(F):5'- ATTTCGCTACCCAGAGCG -3'
(R):5'- CGTCGATCTGGCCCATG -3'
Posted On2019-06-07