Incidental Mutation 'PIT4585001:Gsk3b'
ID556632
Institutional Source Beutler Lab
Gene Symbol Gsk3b
Ensembl Gene ENSMUSG00000022812
Gene Nameglycogen synthase kinase 3 beta
SynonymsGSK-3beta, 7330414F15Rik, GSK3, GSK-3, 8430431H08Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.934) question?
Stock #PIT4585001 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location38089001-38246084 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 38184454 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 129 (N129S)
Ref Sequence ENSEMBL: ENSMUSP00000023507 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023507] [ENSMUST00000114750]
PDB Structure
Crystal structure of a transition state mimic of the GSK-3/Axin complex bound to phosphorylated N-terminal auto-inhibitory pS9 peptide [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000023507
AA Change: N129S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023507
Gene: ENSMUSG00000022812
AA Change: N129S

DomainStartEndE-ValueType
S_TKc 56 340 1.72e-86 SMART
low complexity region 386 402 N/A INTRINSIC
low complexity region 409 419 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114750
AA Change: N129S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110398
Gene: ENSMUSG00000022812
AA Change: N129S

DomainStartEndE-ValueType
S_TKc 56 353 1.13e-86 SMART
low complexity region 399 415 N/A INTRINSIC
low complexity region 422 432 N/A INTRINSIC
Coding Region Coverage
  • 1x: 93.6%
  • 3x: 91.2%
  • 10x: 86.5%
  • 20x: 76.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a serine-threonine kinase, belonging to the glycogen synthase kinase subfamily. It is involved in energy metabolism, neuronal cell development, and body pattern formation. Polymorphisms in this gene have been implicated in modifying risk of Parkinson disease, and studies in mice show that overexpression of this gene may be relevant to the pathogenesis of Alzheimer disease. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for disruptions in this gene may die embryonically around mid-gestation or neonatally. When mice die neonatally, cleft palate and sternum are present. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aurka T C 2: 172,357,197 M318V probably benign Het
Cacna2d1 T A 5: 16,326,344 D560E probably damaging Het
Ccdc148 T A 2: 58,982,976 T202S probably benign Het
Ccdc155 C T 7: 45,200,271 G76D probably benign Het
Cdc42bpb T C 12: 111,304,978 D1149G probably damaging Het
Clasp1 T A 1: 118,462,555 N156K probably damaging Het
Cox18 G A 5: 90,217,575 T255I possibly damaging Het
Cse1l A G 2: 166,941,474 T783A probably damaging Het
Dnajc16 T C 4: 141,764,685 Y609C probably damaging Het
Doc2g A G 19: 4,006,630 T339A probably benign Het
Eif5a T C 11: 69,918,070 probably benign Het
Epha3 A G 16: 63,566,577 probably null Het
Esco1 A T 18: 10,594,355 C310* probably null Het
Fam208b G A 13: 3,574,979 A1657V possibly damaging Het
Fam222a A G 5: 114,611,040 Y99C probably damaging Het
Fzd2 T C 11: 102,605,747 L339P probably damaging Het
Gfral A T 9: 76,197,294 N145K probably damaging Het
Gga1 T A 15: 78,893,790 N618K probably benign Het
Gpatch3 T A 4: 133,583,086 H447Q probably damaging Het
Gpn1 A T 5: 31,509,403 R346* probably null Het
Gsg1 T C 6: 135,237,560 E317G probably benign Het
Hmg20b G T 10: 81,348,955 D94E possibly damaging Het
Klhdc9 T A 1: 171,359,818 H204L possibly damaging Het
Klhl24 A G 16: 20,106,888 I55M probably benign Het
Kmt2c T C 5: 25,315,106 D2002G probably benign Het
Lama4 A G 10: 39,074,746 N1015S probably damaging Het
Lpp T C 16: 24,761,947 C263R probably benign Het
Lrp1b T C 2: 41,269,204 I1689V Het
Mipep C A 14: 60,784,835 Q50K probably benign Het
Mx1 T C 16: 97,456,254 D101G probably benign Het
Nabp2 C G 10: 128,408,807 E37Q possibly damaging Het
Nme6 A G 9: 109,842,036 I115V possibly damaging Het
Nup93 A T 8: 94,243,727 T85S probably benign Het
Oit3 T A 10: 59,431,013 I224F possibly damaging Het
Parp14 T C 16: 35,858,605 K331R probably benign Het
Pls1 T A 9: 95,761,390 T519S probably benign Het
Rcn3 A G 7: 45,086,694 F197L probably benign Het
Rnf213 C T 11: 119,458,392 T3773I Het
Rprd1b A T 2: 158,047,957 I153L probably benign Het
Scel A G 14: 103,592,368 D462G possibly damaging Het
Sh3bp1 C T 15: 78,910,076 S548L possibly damaging Het
Sim1 T A 10: 50,984,188 Y715* probably null Het
Slc18a2 A T 19: 59,293,861 Q500L possibly damaging Het
Slc5a8 T G 10: 88,886,503 M66R probably damaging Het
Slco1a6 T C 6: 142,109,520 T233A probably damaging Het
Smu1 T C 4: 40,739,623 T396A probably benign Het
Tas2r104 T C 6: 131,685,558 T63A possibly damaging Het
Top2a C T 11: 99,001,373 A1088T probably benign Het
Ucp1 T C 8: 83,293,948 F129S probably damaging Het
Unc13b T A 4: 43,091,298 D41E probably benign Het
Usp10 T G 8: 119,954,892 V696G probably benign Het
Xylt2 C T 11: 94,666,240 V745M probably damaging Het
Zbtb49 A T 5: 38,216,476 N41K probably damaging Het
Zfp109 T A 7: 24,229,354 D218V probably benign Het
Zfp420 G A 7: 29,876,005 R550Q probably benign Het
Other mutations in Gsk3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Gsk3b APN 16 38228707 missense probably benign
IGL01302:Gsk3b APN 16 38220018 missense probably benign 0.01
blue_bunny UTSW 16 38208136 intron probably benign
PIT4402001:Gsk3b UTSW 16 38089401 unclassified probably benign
R0670:Gsk3b UTSW 16 38144316 missense probably damaging 1.00
R1118:Gsk3b UTSW 16 38207984 unclassified probably benign
R1119:Gsk3b UTSW 16 38207984 unclassified probably benign
R1428:Gsk3b UTSW 16 38090575 missense probably benign 0.01
R1897:Gsk3b UTSW 16 38217084 splice site probably null
R2056:Gsk3b UTSW 16 38187909 missense probably benign
R2058:Gsk3b UTSW 16 38187909 missense probably benign
R2059:Gsk3b UTSW 16 38187909 missense probably benign
R4428:Gsk3b UTSW 16 38193936 missense probably damaging 1.00
R4594:Gsk3b UTSW 16 38170701 missense possibly damaging 0.92
R5133:Gsk3b UTSW 16 38240520 missense probably damaging 0.99
R5134:Gsk3b UTSW 16 38240520 missense probably damaging 0.99
R5726:Gsk3b UTSW 16 38208136 intron probably benign
R5957:Gsk3b UTSW 16 38193953 missense probably damaging 1.00
R6273:Gsk3b UTSW 16 38208046 missense probably benign 0.00
R6431:Gsk3b UTSW 16 38193949 missense probably damaging 0.99
R8344:Gsk3b UTSW 16 38191625 missense probably benign 0.07
Z1176:Gsk3b UTSW 16 38208070 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GATGGGACTCTTAACTATACTGGG -3'
(R):5'- TGGGGTTGACACATCCCAAC -3'

Sequencing Primer
(F):5'- AGGTGCATTTGTTCAGCTCTATTC -3'
(R):5'- CCTTACCCATGGCTCACACAAAATG -3'
Posted On2019-06-07