Incidental Mutation 'PIT4585001:Esco1'
ID556635
Institutional Source Beutler Lab
Gene Symbol Esco1
Ensembl Gene ENSMUSG00000024293
Gene Nameestablishment of sister chromatid cohesion N-acetyltransferase 1
SynonymsA930014I12Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.275) question?
Stock #PIT4585001 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location10566602-10610352 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 10594355 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 310 (C310*)
Ref Sequence ENSEMBL: ENSMUSP00000025142 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025142] [ENSMUST00000097670] [ENSMUST00000115864]
Predicted Effect probably null
Transcript: ENSMUST00000025142
AA Change: C310*
SMART Domains Protein: ENSMUSP00000025142
Gene: ENSMUSG00000024293
AA Change: C310*

DomainStartEndE-ValueType
coiled coil region 8 32 N/A INTRINSIC
low complexity region 117 128 N/A INTRINSIC
low complexity region 322 338 N/A INTRINSIC
low complexity region 463 477 N/A INTRINSIC
Pfam:zf-C2H2_3 607 646 4.7e-17 PFAM
Pfam:Acetyltransf_13 766 834 1.3e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000097670
SMART Domains Protein: ENSMUSP00000095274
Gene: ENSMUSG00000024293

DomainStartEndE-ValueType
Pfam:zf-C2H2_3 108 148 1.7e-19 PFAM
Pfam:Acetyltransf_13 266 335 4.6e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115864
SMART Domains Protein: ENSMUSP00000111530
Gene: ENSMUSG00000024293

DomainStartEndE-ValueType
Pfam:zf-C2H2_3 83 123 1.8e-19 PFAM
Pfam:Acetyltransf_13 241 310 4.1e-35 PFAM
Coding Region Coverage
  • 1x: 93.6%
  • 3x: 91.2%
  • 10x: 86.5%
  • 20x: 76.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ESCO1 belongs to a conserved family of acetyltransferases involved in sister chromatid cohesion (Hou and Zou, 2005 [PubMed 15958495]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aurka T C 2: 172,357,197 M318V probably benign Het
Cacna2d1 T A 5: 16,326,344 D560E probably damaging Het
Ccdc148 T A 2: 58,982,976 T202S probably benign Het
Ccdc155 C T 7: 45,200,271 G76D probably benign Het
Cdc42bpb T C 12: 111,304,978 D1149G probably damaging Het
Clasp1 T A 1: 118,462,555 N156K probably damaging Het
Cox18 G A 5: 90,217,575 T255I possibly damaging Het
Cse1l A G 2: 166,941,474 T783A probably damaging Het
Dnajc16 T C 4: 141,764,685 Y609C probably damaging Het
Doc2g A G 19: 4,006,630 T339A probably benign Het
Eif5a T C 11: 69,918,070 probably benign Het
Epha3 A G 16: 63,566,577 probably null Het
Fam208b G A 13: 3,574,979 A1657V possibly damaging Het
Fam222a A G 5: 114,611,040 Y99C probably damaging Het
Fzd2 T C 11: 102,605,747 L339P probably damaging Het
Gfral A T 9: 76,197,294 N145K probably damaging Het
Gga1 T A 15: 78,893,790 N618K probably benign Het
Gpatch3 T A 4: 133,583,086 H447Q probably damaging Het
Gpn1 A T 5: 31,509,403 R346* probably null Het
Gsg1 T C 6: 135,237,560 E317G probably benign Het
Gsk3b A G 16: 38,184,454 N129S probably damaging Het
Hmg20b G T 10: 81,348,955 D94E possibly damaging Het
Klhdc9 T A 1: 171,359,818 H204L possibly damaging Het
Klhl24 A G 16: 20,106,888 I55M probably benign Het
Kmt2c T C 5: 25,315,106 D2002G probably benign Het
Lama4 A G 10: 39,074,746 N1015S probably damaging Het
Lpp T C 16: 24,761,947 C263R probably benign Het
Lrp1b T C 2: 41,269,204 I1689V Het
Mipep C A 14: 60,784,835 Q50K probably benign Het
Mx1 T C 16: 97,456,254 D101G probably benign Het
Nabp2 C G 10: 128,408,807 E37Q possibly damaging Het
Nme6 A G 9: 109,842,036 I115V possibly damaging Het
Nup93 A T 8: 94,243,727 T85S probably benign Het
Oit3 T A 10: 59,431,013 I224F possibly damaging Het
Parp14 T C 16: 35,858,605 K331R probably benign Het
Pls1 T A 9: 95,761,390 T519S probably benign Het
Rcn3 A G 7: 45,086,694 F197L probably benign Het
Rnf213 C T 11: 119,458,392 T3773I Het
Rprd1b A T 2: 158,047,957 I153L probably benign Het
Scel A G 14: 103,592,368 D462G possibly damaging Het
Sh3bp1 C T 15: 78,910,076 S548L possibly damaging Het
Sim1 T A 10: 50,984,188 Y715* probably null Het
Slc18a2 A T 19: 59,293,861 Q500L possibly damaging Het
Slc5a8 T G 10: 88,886,503 M66R probably damaging Het
Slco1a6 T C 6: 142,109,520 T233A probably damaging Het
Smu1 T C 4: 40,739,623 T396A probably benign Het
Tas2r104 T C 6: 131,685,558 T63A possibly damaging Het
Top2a C T 11: 99,001,373 A1088T probably benign Het
Ucp1 T C 8: 83,293,948 F129S probably damaging Het
Unc13b T A 4: 43,091,298 D41E probably benign Het
Usp10 T G 8: 119,954,892 V696G probably benign Het
Xylt2 C T 11: 94,666,240 V745M probably damaging Het
Zbtb49 A T 5: 38,216,476 N41K probably damaging Het
Zfp109 T A 7: 24,229,354 D218V probably benign Het
Zfp420 G A 7: 29,876,005 R550Q probably benign Het
Other mutations in Esco1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00673:Esco1 APN 18 10582078 missense probably damaging 1.00
IGL01376:Esco1 APN 18 10594892 nonsense probably null
IGL01886:Esco1 APN 18 10595262 missense probably damaging 1.00
IGL03171:Esco1 APN 18 10594263 missense probably damaging 1.00
IGL03233:Esco1 APN 18 10574877 missense probably damaging 1.00
PIT4576001:Esco1 UTSW 18 10572093 missense probably damaging 1.00
R0266:Esco1 UTSW 18 10594605 missense probably benign 0.00
R0445:Esco1 UTSW 18 10574989 missense probably damaging 1.00
R0494:Esco1 UTSW 18 10594940 missense probably benign 0.28
R0965:Esco1 UTSW 18 10567570 missense probably damaging 1.00
R1834:Esco1 UTSW 18 10594350 missense probably damaging 1.00
R2140:Esco1 UTSW 18 10574873 critical splice donor site probably null
R2141:Esco1 UTSW 18 10574873 critical splice donor site probably null
R2142:Esco1 UTSW 18 10574873 critical splice donor site probably null
R4562:Esco1 UTSW 18 10595074 missense possibly damaging 0.74
R4668:Esco1 UTSW 18 10594734 missense possibly damaging 0.60
R5083:Esco1 UTSW 18 10594734 missense probably benign 0.00
R5128:Esco1 UTSW 18 10567468 utr 3 prime probably benign
R5407:Esco1 UTSW 18 10574886 missense probably damaging 1.00
R5454:Esco1 UTSW 18 10584327 missense probably benign
R5870:Esco1 UTSW 18 10593744 critical splice donor site probably null
R5965:Esco1 UTSW 18 10593867 missense possibly damaging 0.94
R6360:Esco1 UTSW 18 10574931 missense probably damaging 1.00
R6390:Esco1 UTSW 18 10567528 missense probably damaging 1.00
R6438:Esco1 UTSW 18 10572031 missense probably damaging 1.00
R6524:Esco1 UTSW 18 10582188 critical splice acceptor site probably null
R6534:Esco1 UTSW 18 10594794 missense possibly damaging 0.90
R6633:Esco1 UTSW 18 10595738 intron probably benign
Predicted Primers PCR Primer
(F):5'- TCCTACTGGGAAAGAACCGATTAG -3'
(R):5'- AAACCTGTGCCTGTAACTGC -3'

Sequencing Primer
(F):5'- ATTAGAGCGCACATCCTGG -3'
(R):5'- CCTGTGCCTGTAACTGCTGATATTAG -3'
Posted On2019-06-07