Incidental Mutation 'PIT4585001:Slc18a2'
ID556637
Institutional Source Beutler Lab
Gene Symbol Slc18a2
Ensembl Gene ENSMUSG00000025094
Gene Namesolute carrier family 18 (vesicular monoamine), member 2
SynonymsVmat2, 1110037L13Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #PIT4585001 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location59260878-59296012 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 59293861 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 500 (Q500L)
Ref Sequence ENSEMBL: ENSMUSP00000026084 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026084] [ENSMUST00000099274]
Predicted Effect possibly damaging
Transcript: ENSMUST00000026084
AA Change: Q500L

PolyPhen 2 Score 0.468 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000026084
Gene: ENSMUSG00000025094
AA Change: Q500L

DomainStartEndE-ValueType
Pfam:MFS_1 22 428 6.8e-40 PFAM
Pfam:Sugar_tr 26 284 5.9e-10 PFAM
Pfam:MFS_2 127 457 4.3e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000099274
SMART Domains Protein: ENSMUSP00000096880
Gene: ENSMUSG00000074746

DomainStartEndE-ValueType
transmembrane domain 2 24 N/A INTRINSIC
low complexity region 75 90 N/A INTRINSIC
PDZ 374 448 2.02e-10 SMART
low complexity region 582 596 N/A INTRINSIC
low complexity region 802 814 N/A INTRINSIC
C1 834 884 8.31e-8 SMART
coiled coil region 1021 1057 N/A INTRINSIC
Coding Region Coverage
  • 1x: 93.6%
  • 3x: 91.2%
  • 10x: 86.5%
  • 20x: 76.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The vesicular monoamine transporter acts to accumulate cytosolic monoamines into synaptic vesicles, using the proton gradient maintained across the synaptic vesicular membrane. Its proper function is essential to the correct activity of the monoaminergic systems that have been implicated in several human neuropsychiatric disorders. The transporter is a site of action of important drugs, including reserpine and tetrabenazine (summary by Peter et al., 1993 [PubMed 7905859]). See also SLC18A1 (MIM 193002).[supplied by OMIM, Jan 2011]
PHENOTYPE: Nullizygous mice exhibit early postnatal death accompanied by reduced body size, hypokinesia, and reduced brain monoamine levels. Hypomorphic mutants show impaired olfaction, gastroparesis, altered sleep latency, neuron degeneration, enhanced MPTP sensitivity, anxiety- and depressive-like behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aurka T C 2: 172,357,197 M318V probably benign Het
Cacna2d1 T A 5: 16,326,344 D560E probably damaging Het
Ccdc148 T A 2: 58,982,976 T202S probably benign Het
Ccdc155 C T 7: 45,200,271 G76D probably benign Het
Cdc42bpb T C 12: 111,304,978 D1149G probably damaging Het
Clasp1 T A 1: 118,462,555 N156K probably damaging Het
Cox18 G A 5: 90,217,575 T255I possibly damaging Het
Cse1l A G 2: 166,941,474 T783A probably damaging Het
Dnajc16 T C 4: 141,764,685 Y609C probably damaging Het
Doc2g A G 19: 4,006,630 T339A probably benign Het
Eif5a T C 11: 69,918,070 probably benign Het
Epha3 A G 16: 63,566,577 probably null Het
Esco1 A T 18: 10,594,355 C310* probably null Het
Fam208b G A 13: 3,574,979 A1657V possibly damaging Het
Fam222a A G 5: 114,611,040 Y99C probably damaging Het
Fzd2 T C 11: 102,605,747 L339P probably damaging Het
Gfral A T 9: 76,197,294 N145K probably damaging Het
Gga1 T A 15: 78,893,790 N618K probably benign Het
Gpatch3 T A 4: 133,583,086 H447Q probably damaging Het
Gpn1 A T 5: 31,509,403 R346* probably null Het
Gsg1 T C 6: 135,237,560 E317G probably benign Het
Gsk3b A G 16: 38,184,454 N129S probably damaging Het
Hmg20b G T 10: 81,348,955 D94E possibly damaging Het
Klhdc9 T A 1: 171,359,818 H204L possibly damaging Het
Klhl24 A G 16: 20,106,888 I55M probably benign Het
Kmt2c T C 5: 25,315,106 D2002G probably benign Het
Lama4 A G 10: 39,074,746 N1015S probably damaging Het
Lpp T C 16: 24,761,947 C263R probably benign Het
Lrp1b T C 2: 41,269,204 I1689V Het
Mipep C A 14: 60,784,835 Q50K probably benign Het
Mx1 T C 16: 97,456,254 D101G probably benign Het
Nabp2 C G 10: 128,408,807 E37Q possibly damaging Het
Nme6 A G 9: 109,842,036 I115V possibly damaging Het
Nup93 A T 8: 94,243,727 T85S probably benign Het
Oit3 T A 10: 59,431,013 I224F possibly damaging Het
Parp14 T C 16: 35,858,605 K331R probably benign Het
Pls1 T A 9: 95,761,390 T519S probably benign Het
Rcn3 A G 7: 45,086,694 F197L probably benign Het
Rnf213 C T 11: 119,458,392 T3773I Het
Rprd1b A T 2: 158,047,957 I153L probably benign Het
Scel A G 14: 103,592,368 D462G possibly damaging Het
Sh3bp1 C T 15: 78,910,076 S548L possibly damaging Het
Sim1 T A 10: 50,984,188 Y715* probably null Het
Slc5a8 T G 10: 88,886,503 M66R probably damaging Het
Slco1a6 T C 6: 142,109,520 T233A probably damaging Het
Smu1 T C 4: 40,739,623 T396A probably benign Het
Tas2r104 T C 6: 131,685,558 T63A possibly damaging Het
Top2a C T 11: 99,001,373 A1088T probably benign Het
Ucp1 T C 8: 83,293,948 F129S probably damaging Het
Unc13b T A 4: 43,091,298 D41E probably benign Het
Usp10 T G 8: 119,954,892 V696G probably benign Het
Xylt2 C T 11: 94,666,240 V745M probably damaging Het
Zbtb49 A T 5: 38,216,476 N41K probably damaging Het
Zfp109 T A 7: 24,229,354 D218V probably benign Het
Zfp420 G A 7: 29,876,005 R550Q probably benign Het
Other mutations in Slc18a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00837:Slc18a2 APN 19 59284384 missense probably benign 0.02
IGL01956:Slc18a2 APN 19 59287176 splice site probably benign
IGL02220:Slc18a2 APN 19 59276556 missense probably benign 0.01
IGL02389:Slc18a2 APN 19 59263301 splice site probably benign
IGL02795:Slc18a2 APN 19 59274490 splice site probably benign
R0373:Slc18a2 UTSW 19 59287367 missense probably benign
R1972:Slc18a2 UTSW 19 59274653 missense possibly damaging 0.89
R2018:Slc18a2 UTSW 19 59276505 missense possibly damaging 0.90
R3508:Slc18a2 UTSW 19 59273557 missense probably benign 0.03
R5313:Slc18a2 UTSW 19 59293843 missense probably benign 0.04
R5574:Slc18a2 UTSW 19 59261405 missense probably benign 0.09
R6102:Slc18a2 UTSW 19 59293878 missense probably benign 0.00
R7569:Slc18a2 UTSW 19 59284152 missense probably damaging 0.96
R7607:Slc18a2 UTSW 19 59284358 missense probably benign 0.43
R7818:Slc18a2 UTSW 19 59263161 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGAAACTCTCCACTGCGTG -3'
(R):5'- TGGCAGTCGATCATAACCATG -3'

Sequencing Primer
(F):5'- CCTTCAGGGTCAAGACATTCGATG -3'
(R):5'- GCAGTCGATCATAACCATGAAAAAG -3'
Posted On2019-06-07