Incidental Mutation 'PIT4651001:Bard1'
ID556638
Institutional Source Beutler Lab
Gene Symbol Bard1
Ensembl Gene ENSMUSG00000026196
Gene NameBRCA1 associated RING domain 1
SynonymsENSMUSG00000060893, ENSMUSG00000073653
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #PIT4651001 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location71027498-71103146 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 71074928 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 298 (V298A)
Ref Sequence ENSEMBL: ENSMUSP00000027393 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027393]
Predicted Effect probably benign
Transcript: ENSMUST00000027393
AA Change: V298A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000027393
Gene: ENSMUSG00000026196
AA Change: V298A

DomainStartEndE-ValueType
low complexity region 32 43 N/A INTRINSIC
RING 44 80 3.71e-2 SMART
low complexity region 225 232 N/A INTRINSIC
low complexity region 371 390 N/A INTRINSIC
ANK 415 444 3.46e-4 SMART
ANK 448 477 8.32e-7 SMART
ANK 481 510 1.55e-6 SMART
BRCT 553 631 3.56e-10 SMART
BRCT 657 758 2.35e-10 SMART
Coding Region Coverage
  • 1x: 93.1%
  • 3x: 90.7%
  • 10x: 84.4%
  • 20x: 70.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which interacts with the N-terminal region of BRCA1. In addition to its ability to bind BRCA1 in vivo and in vitro, it shares homology with the 2 most conserved regions of BRCA1: the N-terminal RING motif and the C-terminal BRCT domain. The RING motif is a cysteine-rich sequence found in a variety of proteins that regulate cell growth, including the products of tumor suppressor genes and dominant protooncogenes. This protein also contains 3 tandem ankyrin repeats. The BARD1/BRCA1 interaction is disrupted by tumorigenic amino acid substitutions in BRCA1, implying that the formation of a stable complex between these proteins may be an essential aspect of BRCA1 tumor suppression. This protein may be the target of oncogenic mutations in breast or ovarian cancer. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2013]
PHENOTYPE: Mice homozygous for disruptions of this gene fail to develop past the egg cylinder stage. The phenotype is similar to that of mice with homozygous for disruptions in Brca1 or homozygous for disruptions in both Bard1 and Brca1. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A T 13: 77,259,895 I428L probably benign Het
Aass T C 6: 23,118,751 I131V probably benign Het
Alcam T A 16: 52,295,187 K189N probably benign Het
Ankrd50 C A 3: 38,455,810 E803* probably null Het
Ankrd53 A G 6: 83,765,733 D236G probably damaging Het
Cacna1d C T 14: 30,178,645 G361D probably damaging Het
Camkk1 A G 11: 73,025,821 S82G probably benign Het
Ccr4 A T 9: 114,492,193 V268E probably benign Het
Cdh6 G A 15: 13,044,719 S439L possibly damaging Het
Ces1e G T 8: 93,215,083 A254E probably benign Het
Cfap46 T C 7: 139,645,551 T1078A Het
Cyp46a1 A G 12: 108,353,108 D288G probably benign Het
Dnah6 T C 6: 73,060,260 N3333S probably benign Het
Dzip3 A G 16: 48,944,878 V491A probably benign Het
Egr1 G T 18: 34,863,187 E341* probably null Het
Enpp1 G A 10: 24,653,950 P597S probably benign Het
Ercc3 A T 18: 32,240,312 probably benign Het
Fam160a1 C T 3: 85,683,641 A389T probably damaging Het
Fbn1 T C 2: 125,363,989 probably null Het
Fbxw11 T C 11: 32,711,999 probably null Het
Gbf1 A G 19: 46,163,543 N5S probably benign Het
Gbp4 T A 5: 105,118,423 H584L probably benign Het
Gcgr G T 11: 120,538,142 C402F probably damaging Het
Gm3550 A T 18: 34,737,839 Q142L unknown Het
Grm7 T A 6: 110,646,089 N74K probably benign Het
Hils1 A G 11: 94,968,316 S146G probably benign Het
Hoxa10 T G 6: 52,234,897 N13T possibly damaging Het
Ice1 A T 13: 70,623,921 probably null Het
Il22 C A 10: 118,205,590 N69K probably damaging Het
Il9r A T 11: 32,191,798 H319Q probably benign Het
Itgax A G 7: 128,149,110 T1104A probably benign Het
Jag1 C T 2: 137,101,697 G193D probably damaging Het
Krt13 T A 11: 100,120,036 D164V probably damaging Het
Lepr T C 4: 101,791,997 M865T probably damaging Het
Lmf2 G A 15: 89,352,069 H576Y possibly damaging Het
Lrrc8c C T 5: 105,608,323 H655Y probably benign Het
Mapk6 A T 9: 75,397,587 S183T possibly damaging Het
Mcrs1 A T 15: 99,246,951 Y261N probably damaging Het
Mon1b G A 8: 113,638,622 G194D probably benign Het
Myo18b C T 5: 112,834,435 R1144Q probably benign Het
Myo9b T A 8: 71,342,812 H808Q possibly damaging Het
Ngdn T C 14: 55,016,200 I15T probably benign Het
Nhsl1 T G 10: 18,408,435 S41R probably damaging Het
Numa1 A T 7: 102,013,934 K2089M probably damaging Het
Obscn A G 11: 59,041,681 L4900P probably damaging Het
Olfm4 T A 14: 80,021,485 L391Q probably benign Het
Olfr1034 T C 2: 86,046,518 L12P probably damaging Het
Olfr1459 T A 19: 13,146,627 I11F probably benign Het
Olfr1465 A G 19: 13,314,192 I31T probably benign Het
Olfr705 A G 7: 106,873,523 C241R probably damaging Het
Olfr980 A T 9: 40,006,230 C240S probably damaging Het
Park2 T A 17: 11,067,243 L41Q probably damaging Het
Parn T A 16: 13,631,567 N302Y probably benign Het
Pi4k2b T G 5: 52,748,470 S118A possibly damaging Het
Piwil4 C T 9: 14,708,899 V704I possibly damaging Het
Pm20d2 G A 4: 33,181,715 T296M probably damaging Het
Pmpcb C T 5: 21,746,050 A270V probably benign Het
Pnpt1 T C 11: 29,156,945 probably null Het
Rc3h1 C A 1: 160,963,540 N931K probably benign Het
Rlf A G 4: 121,150,313 V600A probably damaging Het
Rnf219 T A 14: 104,506,256 D129V probably damaging Het
Sall1 T G 8: 89,031,103 Q791P probably damaging Het
Sema3c T A 5: 17,694,733 Y408N probably benign Het
Serpinb13 C T 1: 106,982,844 S66L probably damaging Het
Tmem181a A T 17: 6,300,895 M319L probably benign Het
Trim24 T C 6: 37,900,732 probably null Het
Ttn T A 2: 76,888,934 T7234S unknown Het
Unc13c T A 9: 73,483,739 M2076L possibly damaging Het
Uroc1 C T 6: 90,363,113 R667* probably null Het
Uvrag A G 7: 98,906,520 F456L probably benign Het
Vmn1r215 T C 13: 23,076,360 V190A probably damaging Het
Vmn2r50 T A 7: 10,037,732 T681S probably benign Het
Vmn2r65 T A 7: 84,946,253 T408S probably benign Het
Vps33b A G 7: 80,290,007 D502G probably damaging Het
Other mutations in Bard1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00706:Bard1 APN 1 71031426 missense probably benign 0.08
IGL02128:Bard1 APN 1 71075228 missense possibly damaging 0.66
IGL02249:Bard1 APN 1 71053669 missense probably damaging 1.00
IGL02552:Bard1 APN 1 71065656 splice site probably benign
IGL02661:Bard1 APN 1 71075310 missense probably damaging 1.00
IGL03087:Bard1 APN 1 71067130 missense probably damaging 1.00
R0096:Bard1 UTSW 1 71053730 splice site probably benign
R0328:Bard1 UTSW 1 71046762 missense probably benign 0.29
R0838:Bard1 UTSW 1 71030653 missense probably damaging 1.00
R2007:Bard1 UTSW 1 71031403 missense probably benign 0.00
R2055:Bard1 UTSW 1 71074872 missense probably benign 0.00
R2110:Bard1 UTSW 1 71075391 nonsense probably null
R2237:Bard1 UTSW 1 71074976 missense probably damaging 1.00
R2416:Bard1 UTSW 1 71074652 missense probably benign
R3054:Bard1 UTSW 1 71088231 missense possibly damaging 0.77
R3055:Bard1 UTSW 1 71088231 missense possibly damaging 0.77
R3056:Bard1 UTSW 1 71088231 missense possibly damaging 0.77
R3871:Bard1 UTSW 1 71074940 missense probably benign 0.05
R3905:Bard1 UTSW 1 71067180 missense possibly damaging 0.70
R4117:Bard1 UTSW 1 71046763 missense probably damaging 1.00
R4766:Bard1 UTSW 1 71075174 missense probably benign 0.01
R5230:Bard1 UTSW 1 71053611 critical splice donor site probably null
R5250:Bard1 UTSW 1 71074563 missense probably damaging 1.00
R5531:Bard1 UTSW 1 71046721 missense probably damaging 1.00
R5653:Bard1 UTSW 1 71031429 missense probably benign
R6008:Bard1 UTSW 1 71030750 missense possibly damaging 0.65
R7503:Bard1 UTSW 1 71030836 missense probably damaging 1.00
R7543:Bard1 UTSW 1 71075430 missense probably damaging 1.00
R7750:Bard1 UTSW 1 71066942 intron probably null
R8134:Bard1 UTSW 1 71067138 missense probably damaging 1.00
V8831:Bard1 UTSW 1 71088217 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGTGACATCAACCTGTAGCTG -3'
(R):5'- AGAAGGTTGTCTCCTGTAGCC -3'

Sequencing Primer
(F):5'- ATCAACCTGTAGCTGGCCTGAAG -3'
(R):5'- GAAGGTTGTCTCCTGTAGCCAAATAC -3'
Posted On2019-06-07