Incidental Mutation 'PIT4651001:Ankrd50'
ID556645
Institutional Source Beutler Lab
Gene Symbol Ankrd50
Ensembl Gene ENSMUSG00000044864
Gene Nameankyrin repeat domain 50
SynonymsE430012K20Rik
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.744) question?
Stock #PIT4651001 (G1)
Quality Score215.009
Status Not validated
Chromosome3
Chromosomal Location38449259-38484844 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 38455810 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 803 (E803*)
Ref Sequence ENSEMBL: ENSMUSP00000122842 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094300] [ENSMUST00000120875] [ENSMUST00000156038]
Predicted Effect probably benign
Transcript: ENSMUST00000094300
SMART Domains Protein: ENSMUSP00000091858
Gene: ENSMUSG00000044864

DomainStartEndE-ValueType
ANK 18 47 1.16e-5 SMART
ANK 51 80 3.41e-3 SMART
ANK 84 113 2.9e-6 SMART
ANK 117 147 3.31e-1 SMART
low complexity region 216 243 N/A INTRINSIC
low complexity region 262 282 N/A INTRINSIC
low complexity region 301 332 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120875
SMART Domains Protein: ENSMUSP00000113349
Gene: ENSMUSG00000044864

DomainStartEndE-ValueType
SCOP:d1kaga_ 72 90 4e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000156038
AA Change: E803*
SMART Domains Protein: ENSMUSP00000122842
Gene: ENSMUSG00000044864
AA Change: E803*

DomainStartEndE-ValueType
Blast:ANK 440 472 8e-11 BLAST
ANK 507 536 7.95e-4 SMART
ANK 540 569 1.01e-5 SMART
ANK 573 602 6.81e-3 SMART
ANK 606 635 1.7e-3 SMART
ANK 639 668 7.64e-6 SMART
ANK 672 706 4.5e-3 SMART
ANK 710 739 3.33e-6 SMART
ANK 743 772 5.37e-1 SMART
ANK 776 806 1.65e-1 SMART
ANK 809 838 1.2e-3 SMART
ANK 842 871 3.97e-4 SMART
ANK 875 904 3.06e-5 SMART
ANK 908 937 2.88e-1 SMART
ANK 941 970 1.16e-5 SMART
ANK 974 1003 3.41e-3 SMART
ANK 1007 1036 2.9e-6 SMART
ANK 1040 1070 3.31e-1 SMART
low complexity region 1139 1166 N/A INTRINSIC
low complexity region 1185 1205 N/A INTRINSIC
low complexity region 1224 1255 N/A INTRINSIC
Coding Region Coverage
  • 1x: 93.1%
  • 3x: 90.7%
  • 10x: 84.4%
  • 20x: 70.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A T 13: 77,259,895 I428L probably benign Het
Aass T C 6: 23,118,751 I131V probably benign Het
Alcam T A 16: 52,295,187 K189N probably benign Het
Ankrd53 A G 6: 83,765,733 D236G probably damaging Het
Bard1 A G 1: 71,074,928 V298A probably benign Het
Cacna1d C T 14: 30,178,645 G361D probably damaging Het
Camkk1 A G 11: 73,025,821 S82G probably benign Het
Ccr4 A T 9: 114,492,193 V268E probably benign Het
Cdh6 G A 15: 13,044,719 S439L possibly damaging Het
Ces1e G T 8: 93,215,083 A254E probably benign Het
Cfap46 T C 7: 139,645,551 T1078A Het
Cyp46a1 A G 12: 108,353,108 D288G probably benign Het
Dnah6 T C 6: 73,060,260 N3333S probably benign Het
Dzip3 A G 16: 48,944,878 V491A probably benign Het
Egr1 G T 18: 34,863,187 E341* probably null Het
Enpp1 G A 10: 24,653,950 P597S probably benign Het
Ercc3 A T 18: 32,240,312 probably benign Het
Fam160a1 C T 3: 85,683,641 A389T probably damaging Het
Fbn1 T C 2: 125,363,989 probably null Het
Fbxw11 T C 11: 32,711,999 probably null Het
Gbf1 A G 19: 46,163,543 N5S probably benign Het
Gbp4 T A 5: 105,118,423 H584L probably benign Het
Gcgr G T 11: 120,538,142 C402F probably damaging Het
Gm3550 A T 18: 34,737,839 Q142L unknown Het
Grm7 T A 6: 110,646,089 N74K probably benign Het
Hils1 A G 11: 94,968,316 S146G probably benign Het
Hoxa10 T G 6: 52,234,897 N13T possibly damaging Het
Ice1 A T 13: 70,623,921 probably null Het
Il22 C A 10: 118,205,590 N69K probably damaging Het
Il9r A T 11: 32,191,798 H319Q probably benign Het
Itgax A G 7: 128,149,110 T1104A probably benign Het
Jag1 C T 2: 137,101,697 G193D probably damaging Het
Krt13 T A 11: 100,120,036 D164V probably damaging Het
Lepr T C 4: 101,791,997 M865T probably damaging Het
Lmf2 G A 15: 89,352,069 H576Y possibly damaging Het
Lrrc8c C T 5: 105,608,323 H655Y probably benign Het
Mapk6 A T 9: 75,397,587 S183T possibly damaging Het
Mcrs1 A T 15: 99,246,951 Y261N probably damaging Het
Mon1b G A 8: 113,638,622 G194D probably benign Het
Myo18b C T 5: 112,834,435 R1144Q probably benign Het
Myo9b T A 8: 71,342,812 H808Q possibly damaging Het
Ngdn T C 14: 55,016,200 I15T probably benign Het
Nhsl1 T G 10: 18,408,435 S41R probably damaging Het
Numa1 A T 7: 102,013,934 K2089M probably damaging Het
Obscn A G 11: 59,041,681 L4900P probably damaging Het
Olfm4 T A 14: 80,021,485 L391Q probably benign Het
Olfr1034 T C 2: 86,046,518 L12P probably damaging Het
Olfr1459 T A 19: 13,146,627 I11F probably benign Het
Olfr1465 A G 19: 13,314,192 I31T probably benign Het
Olfr705 A G 7: 106,873,523 C241R probably damaging Het
Olfr980 A T 9: 40,006,230 C240S probably damaging Het
Park2 T A 17: 11,067,243 L41Q probably damaging Het
Parn T A 16: 13,631,567 N302Y probably benign Het
Pi4k2b T G 5: 52,748,470 S118A possibly damaging Het
Piwil4 C T 9: 14,708,899 V704I possibly damaging Het
Pm20d2 G A 4: 33,181,715 T296M probably damaging Het
Pmpcb C T 5: 21,746,050 A270V probably benign Het
Pnpt1 T C 11: 29,156,945 probably null Het
Rc3h1 C A 1: 160,963,540 N931K probably benign Het
Rlf A G 4: 121,150,313 V600A probably damaging Het
Rnf219 T A 14: 104,506,256 D129V probably damaging Het
Sall1 T G 8: 89,031,103 Q791P probably damaging Het
Sema3c T A 5: 17,694,733 Y408N probably benign Het
Serpinb13 C T 1: 106,982,844 S66L probably damaging Het
Tmem181a A T 17: 6,300,895 M319L probably benign Het
Trim24 T C 6: 37,900,732 probably null Het
Ttn T A 2: 76,888,934 T7234S unknown Het
Unc13c T A 9: 73,483,739 M2076L possibly damaging Het
Uroc1 C T 6: 90,363,113 R667* probably null Het
Uvrag A G 7: 98,906,520 F456L probably benign Het
Vmn1r215 T C 13: 23,076,360 V190A probably damaging Het
Vmn2r50 T A 7: 10,037,732 T681S probably benign Het
Vmn2r65 T A 7: 84,946,253 T408S probably benign Het
Vps33b A G 7: 80,290,007 D502G probably damaging Het
Other mutations in Ankrd50
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00979:Ankrd50 APN 3 38452414 utr 3 prime probably benign
BB006:Ankrd50 UTSW 3 38457109 missense probably damaging 1.00
BB016:Ankrd50 UTSW 3 38457109 missense probably damaging 1.00
PIT4378001:Ankrd50 UTSW 3 38455263 missense possibly damaging 0.94
PIT4434001:Ankrd50 UTSW 3 38455263 missense possibly damaging 0.94
R0048:Ankrd50 UTSW 3 38483049 missense probably benign 0.00
R0048:Ankrd50 UTSW 3 38483049 missense probably benign 0.00
R0127:Ankrd50 UTSW 3 38456235 missense probably benign 0.00
R0179:Ankrd50 UTSW 3 38455314 missense possibly damaging 0.61
R0417:Ankrd50 UTSW 3 38456361 missense probably damaging 1.00
R0593:Ankrd50 UTSW 3 38483007 nonsense probably null
R1076:Ankrd50 UTSW 3 38454922 missense probably damaging 0.97
R1127:Ankrd50 UTSW 3 38457187 missense probably benign 0.02
R1169:Ankrd50 UTSW 3 38454252 missense probably damaging 1.00
R1212:Ankrd50 UTSW 3 38455687 missense probably damaging 1.00
R1447:Ankrd50 UTSW 3 38455542 missense probably damaging 1.00
R1864:Ankrd50 UTSW 3 38454461 missense probably benign 0.02
R1900:Ankrd50 UTSW 3 38455387 missense probably damaging 1.00
R1907:Ankrd50 UTSW 3 38454052 missense probably damaging 1.00
R1912:Ankrd50 UTSW 3 38456776 missense probably benign 0.07
R2051:Ankrd50 UTSW 3 38454493 missense probably benign 0.21
R2197:Ankrd50 UTSW 3 38455592 missense probably damaging 1.00
R2403:Ankrd50 UTSW 3 38483085 nonsense probably null
R3716:Ankrd50 UTSW 3 38454150 missense probably damaging 0.99
R3944:Ankrd50 UTSW 3 38452496 missense probably benign 0.03
R3948:Ankrd50 UTSW 3 38482841 missense possibly damaging 0.75
R4483:Ankrd50 UTSW 3 38457531 missense probably damaging 1.00
R4577:Ankrd50 UTSW 3 38455941 missense probably damaging 0.98
R4691:Ankrd50 UTSW 3 38483010 missense probably benign 0.01
R4907:Ankrd50 UTSW 3 38454973 nonsense probably null
R4907:Ankrd50 UTSW 3 38456675 missense probably damaging 0.98
R5135:Ankrd50 UTSW 3 38455803 missense probably damaging 1.00
R5356:Ankrd50 UTSW 3 38456185 missense probably damaging 0.99
R5368:Ankrd50 UTSW 3 38455050 missense probably damaging 1.00
R5534:Ankrd50 UTSW 3 38456082 missense probably damaging 0.99
R6103:Ankrd50 UTSW 3 38454429 missense probably damaging 0.99
R6169:Ankrd50 UTSW 3 38455839 missense probably damaging 1.00
R6653:Ankrd50 UTSW 3 38457361 missense probably damaging 1.00
R7317:Ankrd50 UTSW 3 38483183 missense possibly damaging 0.90
R7469:Ankrd50 UTSW 3 38454193 missense probably damaging 0.99
R7617:Ankrd50 UTSW 3 38484682 unclassified probably benign
R7749:Ankrd50 UTSW 3 38482721 missense probably damaging 1.00
R7929:Ankrd50 UTSW 3 38457109 missense probably damaging 1.00
Z1088:Ankrd50 UTSW 3 38457165 missense probably damaging 0.96
Z1177:Ankrd50 UTSW 3 38455792 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GATTTGTTCTCCAGCAGGATCTG -3'
(R):5'- GAGCAGATGTCGATCACACC -3'

Sequencing Primer
(F):5'- GGATCTGTACACAGTCATAATGGCC -3'
(R):5'- GCAGATGTCGATCACACCGATAAC -3'
Posted On2019-06-07