Incidental Mutation 'PIT4651001:Sema3c'
ID556650
Institutional Source Beutler Lab
Gene Symbol Sema3c
Ensembl Gene ENSMUSG00000028780
Gene Namesema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3C
Synonyms1110036B02Rik, Semae
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #PIT4651001 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location17574281-17730268 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 17694733 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 408 (Y408N)
Ref Sequence ENSEMBL: ENSMUSP00000030568 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030568]
Predicted Effect probably benign
Transcript: ENSMUST00000030568
AA Change: Y408N

PolyPhen 2 Score 0.372 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000030568
Gene: ENSMUSG00000028780
AA Change: Y408N

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Sema 54 495 1.16e-200 SMART
PSI 513 565 2.87e-13 SMART
IG 577 662 7.08e-4 SMART
Coding Region Coverage
  • 1x: 93.1%
  • 3x: 90.7%
  • 10x: 84.4%
  • 20x: 70.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU mutation exhibit perinatal lethality, hypopigmentation and abnormal heart development. Mice homozygous for a knock-out allele exhibit prenatal lethality associated with heart defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A T 13: 77,259,895 I428L probably benign Het
Aass T C 6: 23,118,751 I131V probably benign Het
Alcam T A 16: 52,295,187 K189N probably benign Het
Ankrd50 C A 3: 38,455,810 E803* probably null Het
Ankrd53 A G 6: 83,765,733 D236G probably damaging Het
Bard1 A G 1: 71,074,928 V298A probably benign Het
Cacna1d C T 14: 30,178,645 G361D probably damaging Het
Camkk1 A G 11: 73,025,821 S82G probably benign Het
Ccr4 A T 9: 114,492,193 V268E probably benign Het
Cdh6 G A 15: 13,044,719 S439L possibly damaging Het
Ces1e G T 8: 93,215,083 A254E probably benign Het
Cfap46 T C 7: 139,645,551 T1078A Het
Cyp46a1 A G 12: 108,353,108 D288G probably benign Het
Dnah6 T C 6: 73,060,260 N3333S probably benign Het
Dzip3 A G 16: 48,944,878 V491A probably benign Het
Egr1 G T 18: 34,863,187 E341* probably null Het
Enpp1 G A 10: 24,653,950 P597S probably benign Het
Ercc3 A T 18: 32,240,312 probably benign Het
Fam160a1 C T 3: 85,683,641 A389T probably damaging Het
Fbn1 T C 2: 125,363,989 probably null Het
Fbxw11 T C 11: 32,711,999 probably null Het
Gbf1 A G 19: 46,163,543 N5S probably benign Het
Gbp4 T A 5: 105,118,423 H584L probably benign Het
Gcgr G T 11: 120,538,142 C402F probably damaging Het
Gm3550 A T 18: 34,737,839 Q142L unknown Het
Grm7 T A 6: 110,646,089 N74K probably benign Het
Hils1 A G 11: 94,968,316 S146G probably benign Het
Hoxa10 T G 6: 52,234,897 N13T possibly damaging Het
Ice1 A T 13: 70,623,921 probably null Het
Il22 C A 10: 118,205,590 N69K probably damaging Het
Il9r A T 11: 32,191,798 H319Q probably benign Het
Itgax A G 7: 128,149,110 T1104A probably benign Het
Jag1 C T 2: 137,101,697 G193D probably damaging Het
Krt13 T A 11: 100,120,036 D164V probably damaging Het
Lepr T C 4: 101,791,997 M865T probably damaging Het
Lmf2 G A 15: 89,352,069 H576Y possibly damaging Het
Lrrc8c C T 5: 105,608,323 H655Y probably benign Het
Mapk6 A T 9: 75,397,587 S183T possibly damaging Het
Mcrs1 A T 15: 99,246,951 Y261N probably damaging Het
Mon1b G A 8: 113,638,622 G194D probably benign Het
Myo18b C T 5: 112,834,435 R1144Q probably benign Het
Myo9b T A 8: 71,342,812 H808Q possibly damaging Het
Ngdn T C 14: 55,016,200 I15T probably benign Het
Nhsl1 T G 10: 18,408,435 S41R probably damaging Het
Numa1 A T 7: 102,013,934 K2089M probably damaging Het
Obscn A G 11: 59,041,681 L4900P probably damaging Het
Olfm4 T A 14: 80,021,485 L391Q probably benign Het
Olfr1034 T C 2: 86,046,518 L12P probably damaging Het
Olfr1459 T A 19: 13,146,627 I11F probably benign Het
Olfr1465 A G 19: 13,314,192 I31T probably benign Het
Olfr705 A G 7: 106,873,523 C241R probably damaging Het
Olfr980 A T 9: 40,006,230 C240S probably damaging Het
Park2 T A 17: 11,067,243 L41Q probably damaging Het
Parn T A 16: 13,631,567 N302Y probably benign Het
Pi4k2b T G 5: 52,748,470 S118A possibly damaging Het
Piwil4 C T 9: 14,708,899 V704I possibly damaging Het
Pm20d2 G A 4: 33,181,715 T296M probably damaging Het
Pmpcb C T 5: 21,746,050 A270V probably benign Het
Pnpt1 T C 11: 29,156,945 probably null Het
Rc3h1 C A 1: 160,963,540 N931K probably benign Het
Rlf A G 4: 121,150,313 V600A probably damaging Het
Rnf219 T A 14: 104,506,256 D129V probably damaging Het
Sall1 T G 8: 89,031,103 Q791P probably damaging Het
Serpinb13 C T 1: 106,982,844 S66L probably damaging Het
Tmem181a A T 17: 6,300,895 M319L probably benign Het
Trim24 T C 6: 37,900,732 probably null Het
Ttn T A 2: 76,888,934 T7234S unknown Het
Unc13c T A 9: 73,483,739 M2076L possibly damaging Het
Uroc1 C T 6: 90,363,113 R667* probably null Het
Uvrag A G 7: 98,906,520 F456L probably benign Het
Vmn1r215 T C 13: 23,076,360 V190A probably damaging Het
Vmn2r50 T A 7: 10,037,732 T681S probably benign Het
Vmn2r65 T A 7: 84,946,253 T408S probably benign Het
Vps33b A G 7: 80,290,007 D502G probably damaging Het
Other mutations in Sema3c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00559:Sema3c APN 5 17694860 missense probably damaging 1.00
IGL01528:Sema3c APN 5 17714415 missense probably benign
IGL01618:Sema3c APN 5 17672506 missense probably damaging 1.00
IGL01730:Sema3c APN 5 17711436 missense probably benign 0.01
IGL01762:Sema3c APN 5 17694851 missense possibly damaging 0.81
IGL02049:Sema3c APN 5 17721925 splice site probably benign
IGL02249:Sema3c APN 5 17662963 missense probably damaging 1.00
IGL02657:Sema3c APN 5 17576868 start codon destroyed possibly damaging 0.71
IGL02657:Sema3c APN 5 17662974 missense probably damaging 1.00
IGL03213:Sema3c APN 5 17694639 splice site probably benign
R0031:Sema3c UTSW 5 17694728 missense probably damaging 1.00
R0558:Sema3c UTSW 5 17714415 missense probably benign 0.00
R0964:Sema3c UTSW 5 17721909 missense probably damaging 1.00
R1164:Sema3c UTSW 5 17678314 missense probably benign 0.40
R1351:Sema3c UTSW 5 17678336 missense possibly damaging 0.60
R1368:Sema3c UTSW 5 17678332 missense possibly damaging 0.96
R1480:Sema3c UTSW 5 17682031 missense possibly damaging 0.57
R1880:Sema3c UTSW 5 17727466 nonsense probably null
R1916:Sema3c UTSW 5 17727401 missense probably benign 0.06
R3934:Sema3c UTSW 5 17681940 missense probably damaging 0.97
R4284:Sema3c UTSW 5 17678347 missense probably benign 0.01
R4449:Sema3c UTSW 5 17576846 start gained probably benign
R4545:Sema3c UTSW 5 17694772 missense probably benign 0.01
R4546:Sema3c UTSW 5 17694772 missense probably benign 0.01
R4660:Sema3c UTSW 5 17672513 missense probably damaging 1.00
R4890:Sema3c UTSW 5 17675159 missense probably benign 0.00
R4937:Sema3c UTSW 5 17694686 missense probably benign 0.01
R5065:Sema3c UTSW 5 17727617 missense possibly damaging 0.89
R5145:Sema3c UTSW 5 17727617 missense possibly damaging 0.89
R5452:Sema3c UTSW 5 17717070 critical splice donor site probably null
R5586:Sema3c UTSW 5 17711424 missense probably damaging 0.99
R5811:Sema3c UTSW 5 17675190 splice site probably null
R5886:Sema3c UTSW 5 17681986 missense possibly damaging 0.90
R6120:Sema3c UTSW 5 17727632 missense probably benign 0.00
R6191:Sema3c UTSW 5 17653806 missense probably damaging 1.00
R6318:Sema3c UTSW 5 17672432 missense probably damaging 0.96
R6416:Sema3c UTSW 5 17576961 missense probably damaging 0.99
R6441:Sema3c UTSW 5 17724132 missense possibly damaging 0.96
R6816:Sema3c UTSW 5 17670465 missense probably benign 0.36
R7146:Sema3c UTSW 5 17694703 missense probably benign 0.22
R7526:Sema3c UTSW 5 17727596 missense possibly damaging 0.46
R7832:Sema3c UTSW 5 17694847 missense probably damaging 0.99
R8034:Sema3c UTSW 5 17727482 missense probably damaging 1.00
R8053:Sema3c UTSW 5 17655022 missense probably benign 0.00
R8076:Sema3c UTSW 5 17727364 missense probably benign 0.00
R8264:Sema3c UTSW 5 17676539 intron probably benign
R8359:Sema3c UTSW 5 17653728 missense possibly damaging 0.56
R8437:Sema3c UTSW 5 17662938 missense probably damaging 0.99
Z1176:Sema3c UTSW 5 17727519 missense probably benign 0.04
Z1177:Sema3c UTSW 5 17717031 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCTCAAGACTCTCCTTGTC -3'
(R):5'- GTCAGGTAAAGACTAAACGCCTC -3'

Sequencing Primer
(F):5'- GTCCTTCTCAGAAGATCTTCAATG -3'
(R):5'- GGTAAAGACTAAACGCCTCACTAAAG -3'
Posted On2019-06-07