Incidental Mutation 'PIT4651001:Grm7'
ID556662
Institutional Source Beutler Lab
Gene Symbol Grm7
Ensembl Gene ENSMUSG00000056755
Gene Nameglutamate receptor, metabotropic 7
SynonymsGpr1g, mGlu7a receptor, mGluR7, E130018M02Rik, 6330570A01Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #PIT4651001 (G1)
Quality Score124.008
Status Not validated
Chromosome6
Chromosomal Location110645581-111567230 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 110646089 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 74 (N74K)
Ref Sequence ENSEMBL: ENSMUSP00000133957 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071076] [ENSMUST00000172951] [ENSMUST00000174018]
Predicted Effect probably benign
Transcript: ENSMUST00000071076
AA Change: N74K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000064404
Gene: ENSMUSG00000056755
AA Change: N74K

DomainStartEndE-ValueType
low complexity region 18 32 N/A INTRINSIC
Pfam:ANF_receptor 77 484 3e-108 PFAM
Pfam:Peripla_BP_6 144 371 3e-11 PFAM
Pfam:NCD3G 519 569 1.2e-13 PFAM
Pfam:7tm_3 602 847 5.1e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172951
AA Change: N74K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000133957
Gene: ENSMUSG00000056755
AA Change: N74K

DomainStartEndE-ValueType
low complexity region 18 32 N/A INTRINSIC
Pfam:ANF_receptor 77 484 1.7e-103 PFAM
Pfam:Peripla_BP_6 144 487 1e-12 PFAM
Pfam:NCD3G 519 569 1.2e-17 PFAM
Pfam:7tm_3 600 848 1.4e-87 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174018
AA Change: N74K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000134635
Gene: ENSMUSG00000056755
AA Change: N74K

DomainStartEndE-ValueType
low complexity region 18 32 N/A INTRINSIC
Pfam:ANF_receptor 77 176 4.9e-20 PFAM
Coding Region Coverage
  • 1x: 93.1%
  • 3x: 90.7%
  • 10x: 84.4%
  • 20x: 70.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] L-glutamate is the major excitatory neurotransmitter in the central nervous system, and it activates both ionotropic and metabotropic glutamate receptors. Glutamatergic neurotransmission is involved in most aspects of normal brain function and can be perturbed in many neuropathologic conditions. The metabotropic glutamate receptors are a family of G protein-coupled receptors that have been divided into three groups on the basis of sequence homology, putative signal transduction mechanisms, and pharmacologic properties. Group I includes GRM1 and GRM5, and these receptors have been shown to activate phospholipase C. Group II includes GRM2 and GRM3, while Group III includes GRM4, GRM6, GRM7 and GRM8. Group II and III receptors are linked to the inhibition of the cyclic AMP cascade but differ in their agonist selectivities. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2009]
PHENOTYPE: Nullizygous mice exhibit epilepsy and deficits in fear response and conditioned taste aversion. Homozygotes for a knock-in allele show impaired spatial working memory and higher susceptibility to PTZ. Homozygotes for a reporter allele show impaired coordination and higher susceptibility to metrazol. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A T 13: 77,259,895 I428L probably benign Het
Aass T C 6: 23,118,751 I131V probably benign Het
Alcam T A 16: 52,295,187 K189N probably benign Het
Ankrd50 C A 3: 38,455,810 E803* probably null Het
Ankrd53 A G 6: 83,765,733 D236G probably damaging Het
Bard1 A G 1: 71,074,928 V298A probably benign Het
Cacna1d C T 14: 30,178,645 G361D probably damaging Het
Camkk1 A G 11: 73,025,821 S82G probably benign Het
Ccr4 A T 9: 114,492,193 V268E probably benign Het
Cdh6 G A 15: 13,044,719 S439L possibly damaging Het
Ces1e G T 8: 93,215,083 A254E probably benign Het
Cfap46 T C 7: 139,645,551 T1078A Het
Cyp46a1 A G 12: 108,353,108 D288G probably benign Het
Dnah6 T C 6: 73,060,260 N3333S probably benign Het
Dzip3 A G 16: 48,944,878 V491A probably benign Het
Egr1 G T 18: 34,863,187 E341* probably null Het
Enpp1 G A 10: 24,653,950 P597S probably benign Het
Ercc3 A T 18: 32,240,312 probably benign Het
Fam160a1 C T 3: 85,683,641 A389T probably damaging Het
Fbn1 T C 2: 125,363,989 probably null Het
Fbxw11 T C 11: 32,711,999 probably null Het
Gbf1 A G 19: 46,163,543 N5S probably benign Het
Gbp4 T A 5: 105,118,423 H584L probably benign Het
Gcgr G T 11: 120,538,142 C402F probably damaging Het
Gm3550 A T 18: 34,737,839 Q142L unknown Het
Hils1 A G 11: 94,968,316 S146G probably benign Het
Hoxa10 T G 6: 52,234,897 N13T possibly damaging Het
Ice1 A T 13: 70,623,921 probably null Het
Il22 C A 10: 118,205,590 N69K probably damaging Het
Il9r A T 11: 32,191,798 H319Q probably benign Het
Itgax A G 7: 128,149,110 T1104A probably benign Het
Jag1 C T 2: 137,101,697 G193D probably damaging Het
Krt13 T A 11: 100,120,036 D164V probably damaging Het
Lepr T C 4: 101,791,997 M865T probably damaging Het
Lmf2 G A 15: 89,352,069 H576Y possibly damaging Het
Lrrc8c C T 5: 105,608,323 H655Y probably benign Het
Mapk6 A T 9: 75,397,587 S183T possibly damaging Het
Mcrs1 A T 15: 99,246,951 Y261N probably damaging Het
Mon1b G A 8: 113,638,622 G194D probably benign Het
Myo18b C T 5: 112,834,435 R1144Q probably benign Het
Myo9b T A 8: 71,342,812 H808Q possibly damaging Het
Ngdn T C 14: 55,016,200 I15T probably benign Het
Nhsl1 T G 10: 18,408,435 S41R probably damaging Het
Numa1 A T 7: 102,013,934 K2089M probably damaging Het
Obscn A G 11: 59,041,681 L4900P probably damaging Het
Olfm4 T A 14: 80,021,485 L391Q probably benign Het
Olfr1034 T C 2: 86,046,518 L12P probably damaging Het
Olfr1459 T A 19: 13,146,627 I11F probably benign Het
Olfr1465 A G 19: 13,314,192 I31T probably benign Het
Olfr705 A G 7: 106,873,523 C241R probably damaging Het
Olfr980 A T 9: 40,006,230 C240S probably damaging Het
Park2 T A 17: 11,067,243 L41Q probably damaging Het
Parn T A 16: 13,631,567 N302Y probably benign Het
Pi4k2b T G 5: 52,748,470 S118A possibly damaging Het
Piwil4 C T 9: 14,708,899 V704I possibly damaging Het
Pm20d2 G A 4: 33,181,715 T296M probably damaging Het
Pmpcb C T 5: 21,746,050 A270V probably benign Het
Pnpt1 T C 11: 29,156,945 probably null Het
Rc3h1 C A 1: 160,963,540 N931K probably benign Het
Rlf A G 4: 121,150,313 V600A probably damaging Het
Rnf219 T A 14: 104,506,256 D129V probably damaging Het
Sall1 T G 8: 89,031,103 Q791P probably damaging Het
Sema3c T A 5: 17,694,733 Y408N probably benign Het
Serpinb13 C T 1: 106,982,844 S66L probably damaging Het
Tmem181a A T 17: 6,300,895 M319L probably benign Het
Trim24 T C 6: 37,900,732 probably null Het
Ttn T A 2: 76,888,934 T7234S unknown Het
Unc13c T A 9: 73,483,739 M2076L possibly damaging Het
Uroc1 C T 6: 90,363,113 R667* probably null Het
Uvrag A G 7: 98,906,520 F456L probably benign Het
Vmn1r215 T C 13: 23,076,360 V190A probably damaging Het
Vmn2r50 T A 7: 10,037,732 T681S probably benign Het
Vmn2r65 T A 7: 84,946,253 T408S probably benign Het
Vps33b A G 7: 80,290,007 D502G probably damaging Het
Other mutations in Grm7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01729:Grm7 APN 6 111246184 missense probably benign 0.14
IGL02058:Grm7 APN 6 111358317 missense probably damaging 1.00
IGL02650:Grm7 APN 6 111358958 missense probably damaging 1.00
IGL02892:Grm7 APN 6 111254020 missense probably damaging 0.99
IGL03074:Grm7 APN 6 111495643 splice site probably null
IGL03185:Grm7 APN 6 110646222 missense possibly damaging 0.84
Appropriated UTSW 6 111495681 missense possibly damaging 0.64
Consumed UTSW 6 111358875 missense probably damaging 1.00
Devoured UTSW 6 111358824 missense probably damaging 1.00
shaky UTSW 6 111495791 nonsense probably null
R0539:Grm7 UTSW 6 111359094 splice site probably benign
R0622:Grm7 UTSW 6 111358496 missense probably damaging 1.00
R1356:Grm7 UTSW 6 111359024 missense probably damaging 1.00
R1762:Grm7 UTSW 6 111358295 missense probably damaging 1.00
R1783:Grm7 UTSW 6 111358295 missense probably damaging 1.00
R1785:Grm7 UTSW 6 111358295 missense probably damaging 1.00
R1816:Grm7 UTSW 6 111495791 nonsense probably null
R1823:Grm7 UTSW 6 111207769 missense probably benign 0.17
R1864:Grm7 UTSW 6 111080423 missense probably benign 0.03
R1894:Grm7 UTSW 6 111358607 missense probably benign
R1987:Grm7 UTSW 6 110914511 missense probably damaging 1.00
R1993:Grm7 UTSW 6 111207808 missense probably benign 0.13
R2138:Grm7 UTSW 6 110646137 missense probably damaging 1.00
R2214:Grm7 UTSW 6 111358997 missense probably damaging 1.00
R2289:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R2296:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R2339:Grm7 UTSW 6 111495681 missense possibly damaging 0.64
R2847:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R2849:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R2879:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R2884:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R2921:Grm7 UTSW 6 111495905 splice site probably null
R2923:Grm7 UTSW 6 111495905 splice site probably null
R3014:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R3015:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R3703:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R3713:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R3963:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R4009:Grm7 UTSW 6 111495722 missense probably damaging 1.00
R4091:Grm7 UTSW 6 110914340 missense probably damaging 1.00
R4131:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R4132:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R4161:Grm7 UTSW 6 111254020 missense probably damaging 0.99
R4329:Grm7 UTSW 6 110914364 missense probably damaging 1.00
R4357:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R4359:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R4379:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R4379:Grm7 UTSW 6 111246374 missense probably benign 0.05
R4380:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R4514:Grm7 UTSW 6 111358304 missense possibly damaging 0.81
R4518:Grm7 UTSW 6 110914546 splice site probably null
R4647:Grm7 UTSW 6 110914383 nonsense probably null
R4714:Grm7 UTSW 6 111080422 missense possibly damaging 0.52
R4775:Grm7 UTSW 6 110914371 missense probably damaging 1.00
R4957:Grm7 UTSW 6 111358863 missense probably damaging 1.00
R5056:Grm7 UTSW 6 111080443 missense probably damaging 0.99
R5062:Grm7 UTSW 6 110646136 missense probably damaging 1.00
R5256:Grm7 UTSW 6 111358221 missense probably benign 0.01
R5431:Grm7 UTSW 6 111358426 missense probably benign
R6026:Grm7 UTSW 6 111501539 nonsense probably null
R6174:Grm7 UTSW 6 111246297 missense probably benign
R6305:Grm7 UTSW 6 111358665 missense probably damaging 1.00
R6318:Grm7 UTSW 6 111358875 missense probably damaging 1.00
R6440:Grm7 UTSW 6 111254020 missense probably damaging 1.00
R6519:Grm7 UTSW 6 111207752 missense probably benign 0.00
R6531:Grm7 UTSW 6 111358425 missense probably benign 0.29
R6888:Grm7 UTSW 6 111358353 missense possibly damaging 0.79
R6949:Grm7 UTSW 6 110646304 missense probably benign 0.03
R6949:Grm7 UTSW 6 111495729 missense probably damaging 1.00
R6989:Grm7 UTSW 6 111207805 missense probably damaging 1.00
R7076:Grm7 UTSW 6 111358152 missense probably benign 0.04
R7203:Grm7 UTSW 6 111358569 missense possibly damaging 0.94
R7208:Grm7 UTSW 6 111358569 missense possibly damaging 0.94
R7217:Grm7 UTSW 6 111358824 missense probably damaging 1.00
R7257:Grm7 UTSW 6 110646118 missense probably damaging 1.00
R7297:Grm7 UTSW 6 110646013 missense probably benign 0.16
R7470:Grm7 UTSW 6 111501515 missense
R7567:Grm7 UTSW 6 111358761 missense probably damaging 0.96
R7806:Grm7 UTSW 6 111246353 nonsense probably null
R8018:Grm7 UTSW 6 111207776 missense probably benign 0.01
R8076:Grm7 UTSW 6 111566039 missense probably damaging 1.00
R8409:Grm7 UTSW 6 110914336 missense probably benign 0.02
R8420:Grm7 UTSW 6 111080354 missense probably benign
Z1176:Grm7 UTSW 6 111358149 missense probably benign 0.01
Z1176:Grm7 UTSW 6 111358490 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGATGAAGTTCCCCTGCTGC -3'
(R):5'- TCTGGCTTGACGAAAACCG -3'

Sequencing Primer
(F):5'- GCGTGCTGGAGGTGCTC -3'
(R):5'- GCTCTCCGTTGGTGCAAC -3'
Posted On2019-06-07