Incidental Mutation 'PIT4651001:Vmn2r50'
ID556663
Institutional Source Beutler Lab
Gene Symbol Vmn2r50
Ensembl Gene ENSMUSG00000094606
Gene Namevomeronasal 2, receptor 50
SynonymsEG434117
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.154) question?
Stock #PIT4651001 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location10037235-10053178 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 10037732 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 681 (T681S)
Ref Sequence ENSEMBL: ENSMUSP00000083478 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074943] [ENSMUST00000086298]
Predicted Effect probably benign
Transcript: ENSMUST00000074943
AA Change: T697S

PolyPhen 2 Score 0.296 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000074476
Gene: ENSMUSG00000094606
AA Change: T697S

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 469 1.4e-32 PFAM
Pfam:NCD3G 512 565 2.9e-20 PFAM
Pfam:7tm_3 597 833 1.3e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000086298
AA Change: T681S

PolyPhen 2 Score 0.296 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000083478
Gene: ENSMUSG00000094606
AA Change: T681S

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 452 7e-31 PFAM
Pfam:NCD3G 496 549 5.3e-19 PFAM
Pfam:7tm_3 579 818 3.9e-78 PFAM
Coding Region Coverage
  • 1x: 93.1%
  • 3x: 90.7%
  • 10x: 84.4%
  • 20x: 70.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A T 13: 77,259,895 I428L probably benign Het
Aass T C 6: 23,118,751 I131V probably benign Het
Alcam T A 16: 52,295,187 K189N probably benign Het
Ankrd50 C A 3: 38,455,810 E803* probably null Het
Ankrd53 A G 6: 83,765,733 D236G probably damaging Het
Bard1 A G 1: 71,074,928 V298A probably benign Het
Cacna1d C T 14: 30,178,645 G361D probably damaging Het
Camkk1 A G 11: 73,025,821 S82G probably benign Het
Ccr4 A T 9: 114,492,193 V268E probably benign Het
Cdh6 G A 15: 13,044,719 S439L possibly damaging Het
Ces1e G T 8: 93,215,083 A254E probably benign Het
Cfap46 T C 7: 139,645,551 T1078A Het
Cyp46a1 A G 12: 108,353,108 D288G probably benign Het
Dnah6 T C 6: 73,060,260 N3333S probably benign Het
Dzip3 A G 16: 48,944,878 V491A probably benign Het
Egr1 G T 18: 34,863,187 E341* probably null Het
Enpp1 G A 10: 24,653,950 P597S probably benign Het
Ercc3 A T 18: 32,240,312 probably benign Het
Fam160a1 C T 3: 85,683,641 A389T probably damaging Het
Fbn1 T C 2: 125,363,989 probably null Het
Fbxw11 T C 11: 32,711,999 probably null Het
Gbf1 A G 19: 46,163,543 N5S probably benign Het
Gbp4 T A 5: 105,118,423 H584L probably benign Het
Gcgr G T 11: 120,538,142 C402F probably damaging Het
Gm3550 A T 18: 34,737,839 Q142L unknown Het
Grm7 T A 6: 110,646,089 N74K probably benign Het
Hils1 A G 11: 94,968,316 S146G probably benign Het
Hoxa10 T G 6: 52,234,897 N13T possibly damaging Het
Ice1 A T 13: 70,623,921 probably null Het
Il22 C A 10: 118,205,590 N69K probably damaging Het
Il9r A T 11: 32,191,798 H319Q probably benign Het
Itgax A G 7: 128,149,110 T1104A probably benign Het
Jag1 C T 2: 137,101,697 G193D probably damaging Het
Krt13 T A 11: 100,120,036 D164V probably damaging Het
Lepr T C 4: 101,791,997 M865T probably damaging Het
Lmf2 G A 15: 89,352,069 H576Y possibly damaging Het
Lrrc8c C T 5: 105,608,323 H655Y probably benign Het
Mapk6 A T 9: 75,397,587 S183T possibly damaging Het
Mcrs1 A T 15: 99,246,951 Y261N probably damaging Het
Mon1b G A 8: 113,638,622 G194D probably benign Het
Myo18b C T 5: 112,834,435 R1144Q probably benign Het
Myo9b T A 8: 71,342,812 H808Q possibly damaging Het
Ngdn T C 14: 55,016,200 I15T probably benign Het
Nhsl1 T G 10: 18,408,435 S41R probably damaging Het
Numa1 A T 7: 102,013,934 K2089M probably damaging Het
Obscn A G 11: 59,041,681 L4900P probably damaging Het
Olfm4 T A 14: 80,021,485 L391Q probably benign Het
Olfr1034 T C 2: 86,046,518 L12P probably damaging Het
Olfr1459 T A 19: 13,146,627 I11F probably benign Het
Olfr1465 A G 19: 13,314,192 I31T probably benign Het
Olfr705 A G 7: 106,873,523 C241R probably damaging Het
Olfr980 A T 9: 40,006,230 C240S probably damaging Het
Park2 T A 17: 11,067,243 L41Q probably damaging Het
Parn T A 16: 13,631,567 N302Y probably benign Het
Pi4k2b T G 5: 52,748,470 S118A possibly damaging Het
Piwil4 C T 9: 14,708,899 V704I possibly damaging Het
Pm20d2 G A 4: 33,181,715 T296M probably damaging Het
Pmpcb C T 5: 21,746,050 A270V probably benign Het
Pnpt1 T C 11: 29,156,945 probably null Het
Rc3h1 C A 1: 160,963,540 N931K probably benign Het
Rlf A G 4: 121,150,313 V600A probably damaging Het
Rnf219 T A 14: 104,506,256 D129V probably damaging Het
Sall1 T G 8: 89,031,103 Q791P probably damaging Het
Sema3c T A 5: 17,694,733 Y408N probably benign Het
Serpinb13 C T 1: 106,982,844 S66L probably damaging Het
Tmem181a A T 17: 6,300,895 M319L probably benign Het
Trim24 T C 6: 37,900,732 probably null Het
Ttn T A 2: 76,888,934 T7234S unknown Het
Unc13c T A 9: 73,483,739 M2076L possibly damaging Het
Uroc1 C T 6: 90,363,113 R667* probably null Het
Uvrag A G 7: 98,906,520 F456L probably benign Het
Vmn1r215 T C 13: 23,076,360 V190A probably damaging Het
Vmn2r65 T A 7: 84,946,253 T408S probably benign Het
Vps33b A G 7: 80,290,007 D502G probably damaging Het
Other mutations in Vmn2r50
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01536:Vmn2r50 APN 7 10037683 missense probably damaging 1.00
IGL01739:Vmn2r50 APN 7 10037437 missense probably damaging 1.00
IGL02351:Vmn2r50 APN 7 10053075 missense probably benign 0.01
IGL02358:Vmn2r50 APN 7 10053075 missense probably benign 0.01
IGL02871:Vmn2r50 APN 7 10047787 missense possibly damaging 0.91
IGL02962:Vmn2r50 APN 7 10050325 missense probably damaging 1.00
IGL03187:Vmn2r50 APN 7 10037441 missense probably damaging 1.00
IGL03346:Vmn2r50 APN 7 10046002 missense probably damaging 0.99
R0530:Vmn2r50 UTSW 7 10047717 missense possibly damaging 0.82
R1291:Vmn2r50 UTSW 7 10037477 missense probably damaging 0.98
R1438:Vmn2r50 UTSW 7 10050135 nonsense probably null
R1713:Vmn2r50 UTSW 7 10037804 missense probably damaging 1.00
R1747:Vmn2r50 UTSW 7 10047678 missense probably benign 0.20
R1750:Vmn2r50 UTSW 7 10052988 missense possibly damaging 0.69
R1918:Vmn2r50 UTSW 7 10047683 missense probably benign 0.03
R2435:Vmn2r50 UTSW 7 10053099 missense probably benign 0.27
R2511:Vmn2r50 UTSW 7 10047713 missense possibly damaging 0.81
R3795:Vmn2r50 UTSW 7 10037924 missense probably benign 0.18
R4156:Vmn2r50 UTSW 7 10040382 missense probably benign 0.12
R4332:Vmn2r50 UTSW 7 10052995 missense probably benign 0.32
R4399:Vmn2r50 UTSW 7 10047907 missense possibly damaging 0.81
R4411:Vmn2r50 UTSW 7 10050308 missense probably damaging 0.99
R4412:Vmn2r50 UTSW 7 10050308 missense probably damaging 0.99
R4413:Vmn2r50 UTSW 7 10050308 missense probably damaging 0.99
R4645:Vmn2r50 UTSW 7 10037235 makesense probably null
R5151:Vmn2r50 UTSW 7 10053043 missense probably benign 0.00
R5175:Vmn2r50 UTSW 7 10037717 missense probably damaging 1.00
R5291:Vmn2r50 UTSW 7 10047825 missense probably damaging 1.00
R5457:Vmn2r50 UTSW 7 10047946 missense probably damaging 0.98
R5559:Vmn2r50 UTSW 7 10037326 missense probably damaging 1.00
R5579:Vmn2r50 UTSW 7 10050089 missense probably benign 0.00
R5711:Vmn2r50 UTSW 7 10040372 missense possibly damaging 0.81
R5759:Vmn2r50 UTSW 7 10047978 missense probably damaging 1.00
R6004:Vmn2r50 UTSW 7 10050059 missense probably benign 0.00
R6394:Vmn2r50 UTSW 7 10040326 missense probably damaging 1.00
R6488:Vmn2r50 UTSW 7 10037717 missense probably damaging 1.00
R6762:Vmn2r50 UTSW 7 10053083 missense probably benign 0.04
R6995:Vmn2r50 UTSW 7 10046037 nonsense probably null
R6998:Vmn2r50 UTSW 7 10037757 missense probably benign 0.03
R7019:Vmn2r50 UTSW 7 10050245 missense probably benign 0.01
R7027:Vmn2r50 UTSW 7 10047612 missense probably damaging 1.00
R7231:Vmn2r50 UTSW 7 10053083 missense probably benign 0.04
R7343:Vmn2r50 UTSW 7 10050350 critical splice acceptor site probably null
R7554:Vmn2r50 UTSW 7 10050139 missense probably null 0.00
R7704:Vmn2r50 UTSW 7 10047738 missense probably benign 0.05
R7768:Vmn2r50 UTSW 7 10037371 missense probably damaging 0.99
R7773:Vmn2r50 UTSW 7 10037635 missense possibly damaging 0.70
R7975:Vmn2r50 UTSW 7 10037345 missense probably benign 0.39
R7987:Vmn2r50 UTSW 7 10038089 missense probably benign 0.14
R7996:Vmn2r50 UTSW 7 10047868 missense probably damaging 0.99
R8062:Vmn2r50 UTSW 7 10040313 critical splice donor site probably null
R8396:Vmn2r50 UTSW 7 10047712 nonsense probably null
X0067:Vmn2r50 UTSW 7 10053027 missense probably damaging 0.99
Z1088:Vmn2r50 UTSW 7 10037500 missense possibly damaging 0.91
Z1088:Vmn2r50 UTSW 7 10046159 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGGCAGGCCAAGTATCCAAG -3'
(R):5'- TCCTATTGTGAAGGCCAATAACAG -3'

Sequencing Primer
(F):5'- GTATCCAAGAACACAGTAGAATGC -3'
(R):5'- TATTGTGAAGGCCAATAACAGAAGCC -3'
Posted On2019-06-07