Incidental Mutation 'PIT4651001:Sall1'
ID556672
Institutional Source Beutler Lab
Gene Symbol Sall1
Ensembl Gene ENSMUSG00000031665
Gene Namespalt like transcription factor 1
SynonymsMsal-3
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.953) question?
Stock #PIT4651001 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location89027235-89044162 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 89031103 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Proline at position 791 (Q791P)
Ref Sequence ENSEMBL: ENSMUSP00000034090 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034090]
Predicted Effect probably damaging
Transcript: ENSMUST00000034090
AA Change: Q791P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000034090
Gene: ENSMUSG00000031665
AA Change: Q791P

DomainStartEndE-ValueType
low complexity region 133 152 N/A INTRINSIC
low complexity region 163 175 N/A INTRINSIC
low complexity region 229 257 N/A INTRINSIC
low complexity region 283 309 N/A INTRINSIC
low complexity region 361 396 N/A INTRINSIC
ZnF_C2H2 450 472 2.57e-3 SMART
ZnF_C2H2 478 500 3.21e-4 SMART
low complexity region 547 569 N/A INTRINSIC
ZnF_C2H2 705 727 3.02e0 SMART
ZnF_C2H2 733 755 8.6e-5 SMART
ZnF_C2H2 765 787 1.6e-4 SMART
low complexity region 842 861 N/A INTRINSIC
ZnF_C2H2 1000 1022 2.91e-2 SMART
ZnF_C2H2 1028 1050 4.94e-5 SMART
ZnF_C2H2 1133 1155 1.38e-3 SMART
ZnF_C2H2 1161 1183 1.22e-4 SMART
low complexity region 1257 1277 N/A INTRINSIC
Coding Region Coverage
  • 1x: 93.1%
  • 3x: 90.7%
  • 10x: 84.4%
  • 20x: 70.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a zinc finger transcriptional repressor and may be part of the NuRD histone deacetylase complex (HDAC). Defects in this gene are a cause of Townes-Brocks syndrome (TBS) as well as bronchio-oto-renal syndrome (BOR). Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit kidney agenesis or dysgenesis and die perinatally. Homozygotes expressing only a truncated protein show renal agenesis, exencephaly, and limb defects; heterozygotes have hearing loss and cystic kidneys. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A T 13: 77,259,895 I428L probably benign Het
Aass T C 6: 23,118,751 I131V probably benign Het
Alcam T A 16: 52,295,187 K189N probably benign Het
Ankrd50 C A 3: 38,455,810 E803* probably null Het
Ankrd53 A G 6: 83,765,733 D236G probably damaging Het
Bard1 A G 1: 71,074,928 V298A probably benign Het
Cacna1d C T 14: 30,178,645 G361D probably damaging Het
Camkk1 A G 11: 73,025,821 S82G probably benign Het
Ccr4 A T 9: 114,492,193 V268E probably benign Het
Cdh6 G A 15: 13,044,719 S439L possibly damaging Het
Ces1e G T 8: 93,215,083 A254E probably benign Het
Cfap46 T C 7: 139,645,551 T1078A Het
Cyp46a1 A G 12: 108,353,108 D288G probably benign Het
Dnah6 T C 6: 73,060,260 N3333S probably benign Het
Dzip3 A G 16: 48,944,878 V491A probably benign Het
Egr1 G T 18: 34,863,187 E341* probably null Het
Enpp1 G A 10: 24,653,950 P597S probably benign Het
Ercc3 A T 18: 32,240,312 probably benign Het
Fam160a1 C T 3: 85,683,641 A389T probably damaging Het
Fbn1 T C 2: 125,363,989 probably null Het
Fbxw11 T C 11: 32,711,999 probably null Het
Gbf1 A G 19: 46,163,543 N5S probably benign Het
Gbp4 T A 5: 105,118,423 H584L probably benign Het
Gcgr G T 11: 120,538,142 C402F probably damaging Het
Gm3550 A T 18: 34,737,839 Q142L unknown Het
Grm7 T A 6: 110,646,089 N74K probably benign Het
Hils1 A G 11: 94,968,316 S146G probably benign Het
Hoxa10 T G 6: 52,234,897 N13T possibly damaging Het
Ice1 A T 13: 70,623,921 probably null Het
Il22 C A 10: 118,205,590 N69K probably damaging Het
Il9r A T 11: 32,191,798 H319Q probably benign Het
Itgax A G 7: 128,149,110 T1104A probably benign Het
Jag1 C T 2: 137,101,697 G193D probably damaging Het
Krt13 T A 11: 100,120,036 D164V probably damaging Het
Lepr T C 4: 101,791,997 M865T probably damaging Het
Lmf2 G A 15: 89,352,069 H576Y possibly damaging Het
Lrrc8c C T 5: 105,608,323 H655Y probably benign Het
Mapk6 A T 9: 75,397,587 S183T possibly damaging Het
Mcrs1 A T 15: 99,246,951 Y261N probably damaging Het
Mon1b G A 8: 113,638,622 G194D probably benign Het
Myo18b C T 5: 112,834,435 R1144Q probably benign Het
Myo9b T A 8: 71,342,812 H808Q possibly damaging Het
Ngdn T C 14: 55,016,200 I15T probably benign Het
Nhsl1 T G 10: 18,408,435 S41R probably damaging Het
Numa1 A T 7: 102,013,934 K2089M probably damaging Het
Obscn A G 11: 59,041,681 L4900P probably damaging Het
Olfm4 T A 14: 80,021,485 L391Q probably benign Het
Olfr1034 T C 2: 86,046,518 L12P probably damaging Het
Olfr1459 T A 19: 13,146,627 I11F probably benign Het
Olfr1465 A G 19: 13,314,192 I31T probably benign Het
Olfr705 A G 7: 106,873,523 C241R probably damaging Het
Olfr980 A T 9: 40,006,230 C240S probably damaging Het
Park2 T A 17: 11,067,243 L41Q probably damaging Het
Parn T A 16: 13,631,567 N302Y probably benign Het
Pi4k2b T G 5: 52,748,470 S118A possibly damaging Het
Piwil4 C T 9: 14,708,899 V704I possibly damaging Het
Pm20d2 G A 4: 33,181,715 T296M probably damaging Het
Pmpcb C T 5: 21,746,050 A270V probably benign Het
Pnpt1 T C 11: 29,156,945 probably null Het
Rc3h1 C A 1: 160,963,540 N931K probably benign Het
Rlf A G 4: 121,150,313 V600A probably damaging Het
Rnf219 T A 14: 104,506,256 D129V probably damaging Het
Sema3c T A 5: 17,694,733 Y408N probably benign Het
Serpinb13 C T 1: 106,982,844 S66L probably damaging Het
Tmem181a A T 17: 6,300,895 M319L probably benign Het
Trim24 T C 6: 37,900,732 probably null Het
Ttn T A 2: 76,888,934 T7234S unknown Het
Unc13c T A 9: 73,483,739 M2076L possibly damaging Het
Uroc1 C T 6: 90,363,113 R667* probably null Het
Uvrag A G 7: 98,906,520 F456L probably benign Het
Vmn1r215 T C 13: 23,076,360 V190A probably damaging Het
Vmn2r50 T A 7: 10,037,732 T681S probably benign Het
Vmn2r65 T A 7: 84,946,253 T408S probably benign Het
Vps33b A G 7: 80,290,007 D502G probably damaging Het
Other mutations in Sall1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01062:Sall1 APN 8 89033344 missense probably damaging 1.00
IGL01670:Sall1 APN 8 89031571 missense probably benign 0.01
IGL01795:Sall1 APN 8 89028680 missense probably benign 0.02
IGL02041:Sall1 APN 8 89031469 missense probably damaging 1.00
IGL02078:Sall1 APN 8 89030375 missense probably damaging 0.99
IGL02105:Sall1 APN 8 89032568 missense probably damaging 0.99
IGL02354:Sall1 APN 8 89033049 missense probably benign 0.10
IGL02727:Sall1 APN 8 89030755 missense probably damaging 1.00
IGL02943:Sall1 APN 8 89031121 missense probably damaging 0.99
IGL03179:Sall1 APN 8 89031661 missense probably benign 0.00
R0089:Sall1 UTSW 8 89030268 missense probably benign 0.09
R0386:Sall1 UTSW 8 89032604 missense probably damaging 1.00
R0532:Sall1 UTSW 8 89033191 missense probably benign
R0555:Sall1 UTSW 8 89031758 missense probably benign 0.16
R1203:Sall1 UTSW 8 89031934 missense probably damaging 1.00
R1406:Sall1 UTSW 8 89032444 missense probably benign 0.34
R1406:Sall1 UTSW 8 89032444 missense probably benign 0.34
R1449:Sall1 UTSW 8 89032483 missense probably benign
R1477:Sall1 UTSW 8 89032882 missense probably damaging 1.00
R1692:Sall1 UTSW 8 89028400 missense probably benign 0.00
R1839:Sall1 UTSW 8 89028716 missense possibly damaging 0.89
R2016:Sall1 UTSW 8 89028409 missense probably benign 0.10
R2041:Sall1 UTSW 8 89032801 missense probably benign
R3808:Sall1 UTSW 8 89031473 nonsense probably null
R3816:Sall1 UTSW 8 89032675 missense probably benign 0.00
R4085:Sall1 UTSW 8 89028509 missense probably benign
R4604:Sall1 UTSW 8 89030341 missense probably damaging 1.00
R4701:Sall1 UTSW 8 89031160 missense probably damaging 1.00
R5760:Sall1 UTSW 8 89028650 missense possibly damaging 0.94
R6091:Sall1 UTSW 8 89028619 missense probably damaging 1.00
R6213:Sall1 UTSW 8 89033058 small deletion probably benign
R6326:Sall1 UTSW 8 89030268 missense probably benign 0.09
R6920:Sall1 UTSW 8 89030393 missense probably damaging 1.00
R6954:Sall1 UTSW 8 89032891 missense probably damaging 1.00
R7395:Sall1 UTSW 8 89030921 missense possibly damaging 0.86
R7396:Sall1 UTSW 8 89032768 missense probably damaging 1.00
R7493:Sall1 UTSW 8 89031053 missense probably benign 0.32
R7555:Sall1 UTSW 8 89033158 missense possibly damaging 0.90
R7672:Sall1 UTSW 8 89031299 missense probably damaging 0.99
R7759:Sall1 UTSW 8 89042351 critical splice donor site probably null
R7834:Sall1 UTSW 8 89033374 missense probably benign 0.42
R7917:Sall1 UTSW 8 89033374 missense probably benign 0.42
R8023:Sall1 UTSW 8 89032543 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATGACAGGCTATCTTGGGAAG -3'
(R):5'- CGCCTTGAAAATGCACTACCG -3'

Sequencing Primer
(F):5'- AGGCTATCTTGGGAAGCGTCC -3'
(R):5'- AGGCCCTTCAAGTGTAAGATCTGC -3'
Posted On2019-06-07