Incidental Mutation 'R0605:Mdm1'
ID55668
Institutional Source Beutler Lab
Gene Symbol Mdm1
Ensembl Gene ENSMUSG00000020212
Gene Nametransformed mouse 3T3 cell double minute 1
SynonymsArrd2, Mdm-1
MMRRC Submission 038794-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.120) question?
Stock #R0605 (G1)
Quality Score151
Status Validated
Chromosome10
Chromosomal Location118141811-118168997 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 118146601 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 47 (T47M)
Ref Sequence ENSEMBL: ENSMUSP00000151424 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020437] [ENSMUST00000163238] [ENSMUST00000164077] [ENSMUST00000169817] [ENSMUST00000219087]
Predicted Effect probably damaging
Transcript: ENSMUST00000020437
AA Change: T47M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000020437
Gene: ENSMUSG00000020212
AA Change: T47M

DomainStartEndE-ValueType
Pfam:MDM1 9 544 1.1e-184 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000163238
AA Change: T47M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000127919
Gene: ENSMUSG00000020212
AA Change: T47M

DomainStartEndE-ValueType
Pfam:MDM1 9 554 1.3e-187 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000164077
AA Change: T47M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000132966
Gene: ENSMUSG00000020212
AA Change: T47M

DomainStartEndE-ValueType
Pfam:MDM1 9 544 5.5e-185 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000169817
AA Change: T47M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000126258
Gene: ENSMUSG00000020212
AA Change: T47M

DomainStartEndE-ValueType
Pfam:MDM1 9 172 8.3e-55 PFAM
Pfam:MDM1 168 509 1e-115 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218011
Predicted Effect probably damaging
Transcript: ENSMUST00000219087
AA Change: T47M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219605
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219827
Meta Mutation Damage Score 0.6657 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.4%
Validation Efficiency 100% (85/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein similar to the mouse double minute 1 protein. The mouse gene is located in double minute (DM) chromatin particles, is amplified in the mouse transformed 3T3 cell line, and the encoded protein is able to bind to p53. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2011]
PHENOTYPE: Mice homozygous for a nonsense point mutation exhibit retinal degeneration, abnormal eye electrophysiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933406P04Rik G A 10: 20,311,227 probably benign Het
Adam28 A T 14: 68,606,600 probably benign Het
Adamts3 A G 5: 89,861,475 W110R possibly damaging Het
Add1 T C 5: 34,614,224 V342A possibly damaging Het
Aff3 A G 1: 38,209,987 S680P probably damaging Het
Ak9 T C 10: 41,345,139 Y322H probably damaging Het
Als2 A G 1: 59,168,414 L1528S probably benign Het
Ass1 A T 2: 31,514,819 N371Y probably damaging Het
Atp6v1a A C 16: 44,111,496 probably null Het
Bpi T C 2: 158,261,394 L103P probably damaging Het
Cd80 G A 16: 38,482,694 V168I probably benign Het
Cfh T C 1: 140,102,358 S926G probably damaging Het
Chrd A T 16: 20,735,439 T304S probably damaging Het
Chsy3 A G 18: 59,409,053 Y421C probably damaging Het
Cmbl T G 15: 31,585,309 V101G probably damaging Het
Colgalt2 T A 1: 152,495,792 probably benign Het
Coq4 C T 2: 29,789,998 Q101* probably null Het
Cr2 T C 1: 195,163,596 probably benign Het
Cry1 T C 10: 85,184,359 D38G probably damaging Het
Dmxl2 T C 9: 54,419,945 D758G probably benign Het
Epsti1 C T 14: 77,927,237 probably benign Het
Fam24b T C 7: 131,327,186 probably benign Het
Fem1c G A 18: 46,505,160 R592C probably benign Het
Foxred1 T C 9: 35,204,882 Y490C possibly damaging Het
Gm14124 A G 2: 150,268,603 I404M unknown Het
Gm9875 A G 2: 13,557,888 K9R unknown Het
Grid2ip T C 5: 143,379,362 S322P probably damaging Het
Gucy1b2 A G 14: 62,403,159 probably benign Het
Hmcn1 A T 1: 150,657,376 probably null Het
Hpdl C T 4: 116,820,787 S159N possibly damaging Het
Hsd17b12 A T 2: 94,033,642 M285K probably benign Het
Icam5 T C 9: 21,032,197 I23T probably benign Het
Kat5 A G 19: 5,608,336 probably benign Het
Lama3 A G 18: 12,506,949 N67S probably benign Het
Lamb2 T C 9: 108,486,105 probably benign Het
Lgals3bp A G 11: 118,393,394 F453S probably damaging Het
Lypd4 A G 7: 24,865,375 Y113H probably damaging Het
Mei1 C A 15: 82,070,150 T52K probably benign Het
Meiob G A 17: 24,818,262 probably benign Het
Ndufaf6 A G 4: 11,051,224 V292A probably damaging Het
Neb T A 2: 52,264,026 M2358L possibly damaging Het
Nlrp1b A G 11: 71,156,179 S1119P possibly damaging Het
Nsmaf A G 4: 6,418,470 probably null Het
Ogfod1 T C 8: 94,047,267 probably benign Het
Olfr1097 T C 2: 86,890,419 Y252C possibly damaging Het
Olfr1410 G T 1: 92,607,896 V20L probably benign Het
Olfr291 T C 7: 84,857,137 I256T probably damaging Het
Osbpl1a T A 18: 12,882,279 probably null Het
Otud7b T A 3: 96,144,959 probably benign Het
P3h3 T A 6: 124,856,035 H185L probably damaging Het
P4htm G A 9: 108,583,724 A183V probably null Het
Peak1 C T 9: 56,227,098 probably benign Het
Phf20l1 A G 15: 66,595,122 K88R probably damaging Het
Phlpp2 A G 8: 109,933,211 N721S probably benign Het
Plagl2 T C 2: 153,235,944 K39R probably benign Het
Plppr1 A T 4: 49,323,466 N252I probably damaging Het
Pom121l2 C T 13: 21,982,036 A159V probably damaging Het
Prom2 C A 2: 127,539,995 probably null Het
Prrc2c T C 1: 162,682,426 T1017A probably damaging Het
Rimbp3 G T 16: 17,211,699 A996S probably damaging Het
Rnf213 A G 11: 119,431,717 T1387A probably benign Het
Scaper A T 9: 55,815,518 probably benign Het
Scara5 A G 14: 65,759,648 E403G possibly damaging Het
Scrib T C 15: 76,067,553 I94V possibly damaging Het
Shank3 T C 15: 89,524,147 F67L possibly damaging Het
Shprh T C 10: 11,207,112 F1562L probably damaging Het
Src C T 2: 157,469,921 T529M probably damaging Het
Sycp2l T A 13: 41,143,466 M341K probably benign Het
Syde1 T C 10: 78,589,095 probably benign Het
Tarsl2 A T 7: 65,678,071 R509S probably damaging Het
Tle6 T A 10: 81,594,346 H324L probably damaging Het
Tnfaip8 ACTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC ACTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC 18: 50,046,845 probably benign Het
Tnfrsf14 T A 4: 154,925,380 K115* probably null Het
Trappc10 T C 10: 78,201,497 N824S possibly damaging Het
Tsc1 C T 2: 28,671,778 S309F probably damaging Het
Ttc21a A G 9: 119,961,842 I885V possibly damaging Het
Ttn C T 2: 76,740,453 A26699T probably damaging Het
Ttn T C 2: 76,948,371 Y1262C unknown Het
Usp49 T C 17: 47,674,926 probably null Het
Vmn1r226 A T 17: 20,687,871 T122S probably benign Het
Vps8 A T 16: 21,559,337 T1033S probably benign Het
Vwf C A 6: 125,685,837 T2728K probably benign Het
Wdr5b T C 16: 36,041,996 S162P probably benign Het
Xrn1 C T 9: 96,026,877 Q1235* probably null Het
Other mutations in Mdm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00494:Mdm1 APN 10 118164441 missense probably damaging 1.00
IGL01400:Mdm1 APN 10 118157251 missense probably damaging 1.00
IGL01504:Mdm1 APN 10 118146600 missense probably damaging 1.00
IGL02070:Mdm1 APN 10 118146618 missense probably damaging 1.00
IGL02149:Mdm1 APN 10 118148065 missense probably damaging 1.00
IGL02817:Mdm1 APN 10 118164346 missense possibly damaging 0.66
IGL03076:Mdm1 APN 10 118159683 missense possibly damaging 0.95
PIT4696001:Mdm1 UTSW 10 118158540 missense probably benign
R0071:Mdm1 UTSW 10 118146796 missense probably damaging 1.00
R0071:Mdm1 UTSW 10 118146796 missense probably damaging 1.00
R0166:Mdm1 UTSW 10 118166680 missense probably damaging 0.96
R0218:Mdm1 UTSW 10 118156878 splice site probably benign
R0446:Mdm1 UTSW 10 118152056 missense probably benign 0.01
R2870:Mdm1 UTSW 10 118150942 missense probably benign 0.02
R2870:Mdm1 UTSW 10 118150942 missense probably benign 0.02
R2873:Mdm1 UTSW 10 118150942 missense probably benign 0.02
R4816:Mdm1 UTSW 10 118146877 missense possibly damaging 0.82
R5571:Mdm1 UTSW 10 118159683 missense possibly damaging 0.95
R5623:Mdm1 UTSW 10 118150789 missense possibly damaging 0.66
R5806:Mdm1 UTSW 10 118166658 missense probably benign
R6537:Mdm1 UTSW 10 118158576 missense probably benign 0.00
R6539:Mdm1 UTSW 10 118150958 critical splice donor site probably null
R6891:Mdm1 UTSW 10 118148032 missense probably benign 0.04
R6952:Mdm1 UTSW 10 118168057 missense probably damaging 1.00
R7176:Mdm1 UTSW 10 118142865 missense probably damaging 1.00
R7346:Mdm1 UTSW 10 118164288 nonsense probably null
R7442:Mdm1 UTSW 10 118146685 missense probably benign 0.16
R7464:Mdm1 UTSW 10 118152266 missense probably benign 0.00
R8068:Mdm1 UTSW 10 118146804 missense possibly damaging 0.91
Z1088:Mdm1 UTSW 10 118158362 missense possibly damaging 0.67
Z1177:Mdm1 UTSW 10 118158496 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TGGACACTGGCCTCAGCATTCAAC -3'
(R):5'- TGAGACCGAGTTCTCTTGGGAACC -3'

Sequencing Primer
(F):5'- tgtgtctgtctgtctgtctg -3'
(R):5'- GCCTCTAGTGAGAGAACTGCTTC -3'
Posted On2013-07-11