Incidental Mutation 'PIT4651001:Il9r'
ID556684
Institutional Source Beutler Lab
Gene Symbol Il9r
Ensembl Gene ENSMUSG00000020279
Gene Nameinterleukin 9 receptor
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #PIT4651001 (G1)
Quality Score182.009
Status Not validated
Chromosome11
Chromosomal Location32187541-32200279 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 32191798 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 319 (H319Q)
Ref Sequence ENSEMBL: ENSMUSP00000119185 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020518] [ENSMUST00000128311] [ENSMUST00000142396] [ENSMUST00000145401]
Predicted Effect probably benign
Transcript: ENSMUST00000020518
SMART Domains Protein: ENSMUSP00000020518
Gene: ENSMUSG00000020279

DomainStartEndE-ValueType
SCOP:d1gh7a2 47 98 1e-3 SMART
Blast:FN3 49 95 4e-22 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000128311
AA Change: H314Q

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000119557
Gene: ENSMUSG00000020279
AA Change: H314Q

DomainStartEndE-ValueType
PDB:4GS7|B 48 254 5e-6 PDB
SCOP:d1gh7a2 143 257 4e-11 SMART
Blast:FN3 146 229 5e-43 BLAST
transmembrane domain 270 292 N/A INTRINSIC
low complexity region 343 352 N/A INTRINSIC
low complexity region 420 431 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142396
AA Change: H319Q

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000119185
Gene: ENSMUSG00000020279
AA Change: H319Q

DomainStartEndE-ValueType
PDB:4GS7|B 53 259 5e-6 PDB
SCOP:d1gh7a2 148 262 3e-11 SMART
Blast:FN3 151 234 5e-43 BLAST
transmembrane domain 275 297 N/A INTRINSIC
low complexity region 348 357 N/A INTRINSIC
low complexity region 425 436 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145401
AA Change: H313Q

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000118204
Gene: ENSMUSG00000020279
AA Change: H313Q

DomainStartEndE-ValueType
Blast:FN3 146 228 3e-42 BLAST
SCOP:d1egja_ 147 256 1e-10 SMART
transmembrane domain 269 291 N/A INTRINSIC
low complexity region 342 351 N/A INTRINSIC
low complexity region 419 430 N/A INTRINSIC
Coding Region Coverage
  • 1x: 93.1%
  • 3x: 90.7%
  • 10x: 84.4%
  • 20x: 70.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytokine receptor that specifically mediates the biological effects of interleukin 9 (IL9). The functional IL9 receptor complex requires this protein as well as the interleukin 2 receptor, gamma (IL2RG), a common gamma subunit shared by the receptors of many different cytokines. The ligand binding of this receptor leads to the activation of various JAK kinases and STAT proteins, which connect to different biologic responses. This gene is located at the pseudoautosomal regions of X and Y chromosomes. Genetic studies suggested an association of this gene with the development of asthma. Multiple pseudogenes on chromosome 9, 10, 16, and 18 have been described. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are more susceptible to experimental autoimmune encephalomyelitis, a defect partially attributable to defective regulatory T cell function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A T 13: 77,259,895 I428L probably benign Het
Aass T C 6: 23,118,751 I131V probably benign Het
Alcam T A 16: 52,295,187 K189N probably benign Het
Ankrd50 C A 3: 38,455,810 E803* probably null Het
Ankrd53 A G 6: 83,765,733 D236G probably damaging Het
Bard1 A G 1: 71,074,928 V298A probably benign Het
Cacna1d C T 14: 30,178,645 G361D probably damaging Het
Camkk1 A G 11: 73,025,821 S82G probably benign Het
Ccr4 A T 9: 114,492,193 V268E probably benign Het
Cdh6 G A 15: 13,044,719 S439L possibly damaging Het
Ces1e G T 8: 93,215,083 A254E probably benign Het
Cfap46 T C 7: 139,645,551 T1078A Het
Cyp46a1 A G 12: 108,353,108 D288G probably benign Het
Dnah6 T C 6: 73,060,260 N3333S probably benign Het
Dzip3 A G 16: 48,944,878 V491A probably benign Het
Egr1 G T 18: 34,863,187 E341* probably null Het
Enpp1 G A 10: 24,653,950 P597S probably benign Het
Ercc3 A T 18: 32,240,312 probably benign Het
Fam160a1 C T 3: 85,683,641 A389T probably damaging Het
Fbn1 T C 2: 125,363,989 probably null Het
Fbxw11 T C 11: 32,711,999 probably null Het
Gbf1 A G 19: 46,163,543 N5S probably benign Het
Gbp4 T A 5: 105,118,423 H584L probably benign Het
Gcgr G T 11: 120,538,142 C402F probably damaging Het
Gm3550 A T 18: 34,737,839 Q142L unknown Het
Grm7 T A 6: 110,646,089 N74K probably benign Het
Hils1 A G 11: 94,968,316 S146G probably benign Het
Hoxa10 T G 6: 52,234,897 N13T possibly damaging Het
Ice1 A T 13: 70,623,921 probably null Het
Il22 C A 10: 118,205,590 N69K probably damaging Het
Itgax A G 7: 128,149,110 T1104A probably benign Het
Jag1 C T 2: 137,101,697 G193D probably damaging Het
Krt13 T A 11: 100,120,036 D164V probably damaging Het
Lepr T C 4: 101,791,997 M865T probably damaging Het
Lmf2 G A 15: 89,352,069 H576Y possibly damaging Het
Lrrc8c C T 5: 105,608,323 H655Y probably benign Het
Mapk6 A T 9: 75,397,587 S183T possibly damaging Het
Mcrs1 A T 15: 99,246,951 Y261N probably damaging Het
Mon1b G A 8: 113,638,622 G194D probably benign Het
Myo18b C T 5: 112,834,435 R1144Q probably benign Het
Myo9b T A 8: 71,342,812 H808Q possibly damaging Het
Ngdn T C 14: 55,016,200 I15T probably benign Het
Nhsl1 T G 10: 18,408,435 S41R probably damaging Het
Numa1 A T 7: 102,013,934 K2089M probably damaging Het
Obscn A G 11: 59,041,681 L4900P probably damaging Het
Olfm4 T A 14: 80,021,485 L391Q probably benign Het
Olfr1034 T C 2: 86,046,518 L12P probably damaging Het
Olfr1459 T A 19: 13,146,627 I11F probably benign Het
Olfr1465 A G 19: 13,314,192 I31T probably benign Het
Olfr705 A G 7: 106,873,523 C241R probably damaging Het
Olfr980 A T 9: 40,006,230 C240S probably damaging Het
Park2 T A 17: 11,067,243 L41Q probably damaging Het
Parn T A 16: 13,631,567 N302Y probably benign Het
Pi4k2b T G 5: 52,748,470 S118A possibly damaging Het
Piwil4 C T 9: 14,708,899 V704I possibly damaging Het
Pm20d2 G A 4: 33,181,715 T296M probably damaging Het
Pmpcb C T 5: 21,746,050 A270V probably benign Het
Pnpt1 T C 11: 29,156,945 probably null Het
Rc3h1 C A 1: 160,963,540 N931K probably benign Het
Rlf A G 4: 121,150,313 V600A probably damaging Het
Rnf219 T A 14: 104,506,256 D129V probably damaging Het
Sall1 T G 8: 89,031,103 Q791P probably damaging Het
Sema3c T A 5: 17,694,733 Y408N probably benign Het
Serpinb13 C T 1: 106,982,844 S66L probably damaging Het
Tmem181a A T 17: 6,300,895 M319L probably benign Het
Trim24 T C 6: 37,900,732 probably null Het
Ttn T A 2: 76,888,934 T7234S unknown Het
Unc13c T A 9: 73,483,739 M2076L possibly damaging Het
Uroc1 C T 6: 90,363,113 R667* probably null Het
Uvrag A G 7: 98,906,520 F456L probably benign Het
Vmn1r215 T C 13: 23,076,360 V190A probably damaging Het
Vmn2r50 T A 7: 10,037,732 T681S probably benign Het
Vmn2r65 T A 7: 84,946,253 T408S probably benign Het
Vps33b A G 7: 80,290,007 D502G probably damaging Het
Other mutations in Il9r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03267:Il9r APN 11 32191778 missense possibly damaging 0.76
PIT4305001:Il9r UTSW 11 32194734 missense probably benign
R1691:Il9r UTSW 11 32191829 missense possibly damaging 0.75
R1695:Il9r UTSW 11 32193227 missense probably benign 0.31
R4816:Il9r UTSW 11 32192654 missense possibly damaging 0.93
R5381:Il9r UTSW 11 32190715 missense probably benign 0.14
R5701:Il9r UTSW 11 32193263 missense probably benign 0.41
R6015:Il9r UTSW 11 32192674 missense probably benign 0.14
R6445:Il9r UTSW 11 32191000 missense possibly damaging 0.92
R6584:Il9r UTSW 11 32191782 missense probably benign 0.01
R6976:Il9r UTSW 11 32193177 nonsense probably null
R7171:Il9r UTSW 11 32192671 missense probably benign 0.15
R7326:Il9r UTSW 11 32194389 missense possibly damaging 0.78
R7948:Il9r UTSW 11 32194486 missense probably damaging 1.00
X0028:Il9r UTSW 11 32190793 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACTATGTGTGTAAGAGGCTCAGAG -3'
(R):5'- AATAGCCCCTTGAGGACAGG -3'

Sequencing Primer
(F):5'- GCTCAGAGCATGAACAAGGCC -3'
(R):5'- AATACAGTGGGCCCATTTGC -3'
Posted On2019-06-07