Incidental Mutation 'PIT4651001:Lmf2'
ID556700
Institutional Source Beutler Lab
Gene Symbol Lmf2
Ensembl Gene ENSMUSG00000022614
Gene Namelipase maturation factor 2
SynonymsTmem153, Tmem112b
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.270) question?
Stock #PIT4651001 (G1)
Quality Score130.008
Status Not validated
Chromosome15
Chromosomal Location89351004-89355659 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 89352069 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 576 (H576Y)
Ref Sequence ENSEMBL: ENSMUSP00000023283 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023283] [ENSMUST00000036987] [ENSMUST00000074552] [ENSMUST00000088717] [ENSMUST00000145259] [ENSMUST00000229111]
Predicted Effect possibly damaging
Transcript: ENSMUST00000023283
AA Change: H576Y

PolyPhen 2 Score 0.582 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000023283
Gene: ENSMUSG00000022614
AA Change: H576Y

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
transmembrane domain 87 109 N/A INTRINSIC
Pfam:LMF1 122 589 5.6e-164 PFAM
low complexity region 679 693 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000036987
SMART Domains Protein: ENSMUSP00000036900
Gene: ENSMUSG00000008690

DomainStartEndE-ValueType
Pfam:DUF1032 20 576 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000074552
SMART Domains Protein: ENSMUSP00000074139
Gene: ENSMUSG00000008690

DomainStartEndE-ValueType
Pfam:DUF1032 51 607 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000088717
SMART Domains Protein: ENSMUSP00000086095
Gene: ENSMUSG00000008690

DomainStartEndE-ValueType
Pfam:CNDH2_N 11 123 1.2e-48 PFAM
Pfam:CNDH2_M 147 285 2.1e-20 PFAM
Pfam:CNDH2_C 308 598 1.9e-90 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145259
Predicted Effect probably benign
Transcript: ENSMUST00000229111
Coding Region Coverage
  • 1x: 93.1%
  • 3x: 90.7%
  • 10x: 84.4%
  • 20x: 70.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A T 13: 77,259,895 I428L probably benign Het
Aass T C 6: 23,118,751 I131V probably benign Het
Alcam T A 16: 52,295,187 K189N probably benign Het
Ankrd50 C A 3: 38,455,810 E803* probably null Het
Ankrd53 A G 6: 83,765,733 D236G probably damaging Het
Bard1 A G 1: 71,074,928 V298A probably benign Het
Cacna1d C T 14: 30,178,645 G361D probably damaging Het
Camkk1 A G 11: 73,025,821 S82G probably benign Het
Ccr4 A T 9: 114,492,193 V268E probably benign Het
Cdh6 G A 15: 13,044,719 S439L possibly damaging Het
Ces1e G T 8: 93,215,083 A254E probably benign Het
Cfap46 T C 7: 139,645,551 T1078A Het
Cyp46a1 A G 12: 108,353,108 D288G probably benign Het
Dnah6 T C 6: 73,060,260 N3333S probably benign Het
Dzip3 A G 16: 48,944,878 V491A probably benign Het
Egr1 G T 18: 34,863,187 E341* probably null Het
Enpp1 G A 10: 24,653,950 P597S probably benign Het
Ercc3 A T 18: 32,240,312 probably benign Het
Fam160a1 C T 3: 85,683,641 A389T probably damaging Het
Fbn1 T C 2: 125,363,989 probably null Het
Fbxw11 T C 11: 32,711,999 probably null Het
Gbf1 A G 19: 46,163,543 N5S probably benign Het
Gbp4 T A 5: 105,118,423 H584L probably benign Het
Gcgr G T 11: 120,538,142 C402F probably damaging Het
Gm3550 A T 18: 34,737,839 Q142L unknown Het
Grm7 T A 6: 110,646,089 N74K probably benign Het
Hils1 A G 11: 94,968,316 S146G probably benign Het
Hoxa10 T G 6: 52,234,897 N13T possibly damaging Het
Ice1 A T 13: 70,623,921 probably null Het
Il22 C A 10: 118,205,590 N69K probably damaging Het
Il9r A T 11: 32,191,798 H319Q probably benign Het
Itgax A G 7: 128,149,110 T1104A probably benign Het
Jag1 C T 2: 137,101,697 G193D probably damaging Het
Krt13 T A 11: 100,120,036 D164V probably damaging Het
Lepr T C 4: 101,791,997 M865T probably damaging Het
Lrrc8c C T 5: 105,608,323 H655Y probably benign Het
Mapk6 A T 9: 75,397,587 S183T possibly damaging Het
Mcrs1 A T 15: 99,246,951 Y261N probably damaging Het
Mon1b G A 8: 113,638,622 G194D probably benign Het
Myo18b C T 5: 112,834,435 R1144Q probably benign Het
Myo9b T A 8: 71,342,812 H808Q possibly damaging Het
Ngdn T C 14: 55,016,200 I15T probably benign Het
Nhsl1 T G 10: 18,408,435 S41R probably damaging Het
Numa1 A T 7: 102,013,934 K2089M probably damaging Het
Obscn A G 11: 59,041,681 L4900P probably damaging Het
Olfm4 T A 14: 80,021,485 L391Q probably benign Het
Olfr1034 T C 2: 86,046,518 L12P probably damaging Het
Olfr1459 T A 19: 13,146,627 I11F probably benign Het
Olfr1465 A G 19: 13,314,192 I31T probably benign Het
Olfr705 A G 7: 106,873,523 C241R probably damaging Het
Olfr980 A T 9: 40,006,230 C240S probably damaging Het
Park2 T A 17: 11,067,243 L41Q probably damaging Het
Parn T A 16: 13,631,567 N302Y probably benign Het
Pi4k2b T G 5: 52,748,470 S118A possibly damaging Het
Piwil4 C T 9: 14,708,899 V704I possibly damaging Het
Pm20d2 G A 4: 33,181,715 T296M probably damaging Het
Pmpcb C T 5: 21,746,050 A270V probably benign Het
Pnpt1 T C 11: 29,156,945 probably null Het
Rc3h1 C A 1: 160,963,540 N931K probably benign Het
Rlf A G 4: 121,150,313 V600A probably damaging Het
Rnf219 T A 14: 104,506,256 D129V probably damaging Het
Sall1 T G 8: 89,031,103 Q791P probably damaging Het
Sema3c T A 5: 17,694,733 Y408N probably benign Het
Serpinb13 C T 1: 106,982,844 S66L probably damaging Het
Tmem181a A T 17: 6,300,895 M319L probably benign Het
Trim24 T C 6: 37,900,732 probably null Het
Ttn T A 2: 76,888,934 T7234S unknown Het
Unc13c T A 9: 73,483,739 M2076L possibly damaging Het
Uroc1 C T 6: 90,363,113 R667* probably null Het
Uvrag A G 7: 98,906,520 F456L probably benign Het
Vmn1r215 T C 13: 23,076,360 V190A probably damaging Het
Vmn2r50 T A 7: 10,037,732 T681S probably benign Het
Vmn2r65 T A 7: 84,946,253 T408S probably benign Het
Vps33b A G 7: 80,290,007 D502G probably damaging Het
Other mutations in Lmf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00896:Lmf2 APN 15 89353336 missense probably benign 0.00
IGL00953:Lmf2 APN 15 89353899 missense probably damaging 1.00
IGL00987:Lmf2 APN 15 89354568 missense probably benign
IGL01069:Lmf2 APN 15 89352888 missense probably benign 0.35
IGL01340:Lmf2 APN 15 89352872 missense probably damaging 0.98
IGL01878:Lmf2 APN 15 89352418 missense probably damaging 1.00
IGL02588:Lmf2 APN 15 89355406 unclassified probably null
IGL02698:Lmf2 APN 15 89354154 missense probably damaging 1.00
R1761:Lmf2 UTSW 15 89352713 missense possibly damaging 0.61
R2355:Lmf2 UTSW 15 89351763 missense possibly damaging 0.65
R2880:Lmf2 UTSW 15 89351653 missense possibly damaging 0.59
R4896:Lmf2 UTSW 15 89351800 missense probably benign 0.16
R5141:Lmf2 UTSW 15 89351607 unclassified probably null
R6785:Lmf2 UTSW 15 89352033 missense probably benign 0.43
R7301:Lmf2 UTSW 15 89355530 start gained probably benign
Predicted Primers PCR Primer
(F):5'- TGTCTGAGCTAGGCCATTGC -3'
(R):5'- GAGCCATGTTGCCAACTACC -3'

Sequencing Primer
(F):5'- GTGGACTCTTATCCTACGGAGAC -3'
(R):5'- ACTACCCCTTTCATGAACGG -3'
Posted On2019-06-07