Incidental Mutation 'PIT4651001:Alcam'
ID556704
Institutional Source Beutler Lab
Gene Symbol Alcam
Ensembl Gene ENSMUSG00000022636
Gene Nameactivated leukocyte cell adhesion molecule
SynonymsSC1, BEN, MuSC, DM-GRASP, CD166
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.412) question?
Stock #PIT4651001 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location52248996-52454074 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 52295187 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 189 (K189N)
Ref Sequence ENSEMBL: ENSMUSP00000023312 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023312] [ENSMUST00000164728] [ENSMUST00000170035]
Predicted Effect probably benign
Transcript: ENSMUST00000023312
AA Change: K189N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000023312
Gene: ENSMUSG00000022636
AA Change: K189N

DomainStartEndE-ValueType
IG 26 131 8.46e-2 SMART
Pfam:C2-set_2 137 231 5.1e-24 PFAM
IG 255 330 6.35e-6 SMART
IG 339 413 6.26e-5 SMART
Pfam:Ig_3 415 489 3.8e-6 PFAM
transmembrane domain 528 550 N/A INTRINSIC
low complexity region 569 582 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164728
AA Change: K189N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000127141
Gene: ENSMUSG00000022636
AA Change: K189N

DomainStartEndE-ValueType
IG 26 131 8.46e-2 SMART
Pfam:C2-set_2 137 231 1e-22 PFAM
Pfam:Ig_2 147 235 3.8e-2 PFAM
IG 255 330 6.35e-6 SMART
IG 339 413 6.26e-5 SMART
Pfam:Ig_3 415 496 1.9e-7 PFAM
Pfam:Ig_2 415 502 1.5e-6 PFAM
transmembrane domain 528 550 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000130563
Gene: ENSMUSG00000022636
AA Change: K37N

DomainStartEndE-ValueType
Pfam:C2-set_2 1 80 3.6e-21 PFAM
IG 101 175 6.26e-5 SMART
Pfam:Ig_3 177 251 1.7e-6 PFAM
transmembrane domain 290 312 N/A INTRINSIC
low complexity region 331 344 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170035
AA Change: K189N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000129714
Gene: ENSMUSG00000022636
AA Change: K189N

DomainStartEndE-ValueType
IG 26 131 8.46e-2 SMART
Pfam:C2-set_2 137 231 3.4e-23 PFAM
Pfam:Ig_2 147 235 1.3e-2 PFAM
IG 255 330 6.35e-6 SMART
IG 339 413 6.26e-5 SMART
Pfam:Ig_3 415 491 5.9e-8 PFAM
Pfam:Ig_2 415 502 4.9e-7 PFAM
transmembrane domain 515 537 N/A INTRINSIC
low complexity region 556 569 N/A INTRINSIC
Coding Region Coverage
  • 1x: 93.1%
  • 3x: 90.7%
  • 10x: 84.4%
  • 20x: 70.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes activated leukocyte cell adhesion molecule (ALCAM), also known as CD166 (cluster of differentiation 166), which is a member of a subfamily of immunoglobulin receptors with five immunoglobulin-like domains (VVC2C2C2) in the extracellular domain. This protein binds to T-cell differentiation antigene CD6, and is implicated in the processes of cell adhesion and migration. Multiple alternatively spliced transcript variants encoding different isoforms have been found. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygous null mice display abnormal motor neuron and retinal ganglion cell morphology and retinal dysplasia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A T 13: 77,259,895 I428L probably benign Het
Aass T C 6: 23,118,751 I131V probably benign Het
Ankrd50 C A 3: 38,455,810 E803* probably null Het
Ankrd53 A G 6: 83,765,733 D236G probably damaging Het
Bard1 A G 1: 71,074,928 V298A probably benign Het
Cacna1d C T 14: 30,178,645 G361D probably damaging Het
Camkk1 A G 11: 73,025,821 S82G probably benign Het
Ccr4 A T 9: 114,492,193 V268E probably benign Het
Cdh6 G A 15: 13,044,719 S439L possibly damaging Het
Ces1e G T 8: 93,215,083 A254E probably benign Het
Cfap46 T C 7: 139,645,551 T1078A Het
Cyp46a1 A G 12: 108,353,108 D288G probably benign Het
Dnah6 T C 6: 73,060,260 N3333S probably benign Het
Dzip3 A G 16: 48,944,878 V491A probably benign Het
Egr1 G T 18: 34,863,187 E341* probably null Het
Enpp1 G A 10: 24,653,950 P597S probably benign Het
Ercc3 A T 18: 32,240,312 probably benign Het
Fam160a1 C T 3: 85,683,641 A389T probably damaging Het
Fbn1 T C 2: 125,363,989 probably null Het
Fbxw11 T C 11: 32,711,999 probably null Het
Gbf1 A G 19: 46,163,543 N5S probably benign Het
Gbp4 T A 5: 105,118,423 H584L probably benign Het
Gcgr G T 11: 120,538,142 C402F probably damaging Het
Gm3550 A T 18: 34,737,839 Q142L unknown Het
Grm7 T A 6: 110,646,089 N74K probably benign Het
Hils1 A G 11: 94,968,316 S146G probably benign Het
Hoxa10 T G 6: 52,234,897 N13T possibly damaging Het
Ice1 A T 13: 70,623,921 probably null Het
Il22 C A 10: 118,205,590 N69K probably damaging Het
Il9r A T 11: 32,191,798 H319Q probably benign Het
Itgax A G 7: 128,149,110 T1104A probably benign Het
Jag1 C T 2: 137,101,697 G193D probably damaging Het
Krt13 T A 11: 100,120,036 D164V probably damaging Het
Lepr T C 4: 101,791,997 M865T probably damaging Het
Lmf2 G A 15: 89,352,069 H576Y possibly damaging Het
Lrrc8c C T 5: 105,608,323 H655Y probably benign Het
Mapk6 A T 9: 75,397,587 S183T possibly damaging Het
Mcrs1 A T 15: 99,246,951 Y261N probably damaging Het
Mon1b G A 8: 113,638,622 G194D probably benign Het
Myo18b C T 5: 112,834,435 R1144Q probably benign Het
Myo9b T A 8: 71,342,812 H808Q possibly damaging Het
Ngdn T C 14: 55,016,200 I15T probably benign Het
Nhsl1 T G 10: 18,408,435 S41R probably damaging Het
Numa1 A T 7: 102,013,934 K2089M probably damaging Het
Obscn A G 11: 59,041,681 L4900P probably damaging Het
Olfm4 T A 14: 80,021,485 L391Q probably benign Het
Olfr1034 T C 2: 86,046,518 L12P probably damaging Het
Olfr1459 T A 19: 13,146,627 I11F probably benign Het
Olfr1465 A G 19: 13,314,192 I31T probably benign Het
Olfr705 A G 7: 106,873,523 C241R probably damaging Het
Olfr980 A T 9: 40,006,230 C240S probably damaging Het
Park2 T A 17: 11,067,243 L41Q probably damaging Het
Parn T A 16: 13,631,567 N302Y probably benign Het
Pi4k2b T G 5: 52,748,470 S118A possibly damaging Het
Piwil4 C T 9: 14,708,899 V704I possibly damaging Het
Pm20d2 G A 4: 33,181,715 T296M probably damaging Het
Pmpcb C T 5: 21,746,050 A270V probably benign Het
Pnpt1 T C 11: 29,156,945 probably null Het
Rc3h1 C A 1: 160,963,540 N931K probably benign Het
Rlf A G 4: 121,150,313 V600A probably damaging Het
Rnf219 T A 14: 104,506,256 D129V probably damaging Het
Sall1 T G 8: 89,031,103 Q791P probably damaging Het
Sema3c T A 5: 17,694,733 Y408N probably benign Het
Serpinb13 C T 1: 106,982,844 S66L probably damaging Het
Tmem181a A T 17: 6,300,895 M319L probably benign Het
Trim24 T C 6: 37,900,732 probably null Het
Ttn T A 2: 76,888,934 T7234S unknown Het
Unc13c T A 9: 73,483,739 M2076L possibly damaging Het
Uroc1 C T 6: 90,363,113 R667* probably null Het
Uvrag A G 7: 98,906,520 F456L probably benign Het
Vmn1r215 T C 13: 23,076,360 V190A probably damaging Het
Vmn2r50 T A 7: 10,037,732 T681S probably benign Het
Vmn2r65 T A 7: 84,946,253 T408S probably benign Het
Vps33b A G 7: 80,290,007 D502G probably damaging Het
Other mutations in Alcam
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Alcam APN 16 52295017 splice site probably benign
IGL00737:Alcam APN 16 52253180 missense unknown
IGL01514:Alcam APN 16 52274290 splice site probably benign
IGL01837:Alcam APN 16 52253168 missense probably benign 0.10
IGL02143:Alcam APN 16 52305619 missense probably damaging 0.99
IGL02231:Alcam APN 16 52274050 splice site probably benign
IGL02375:Alcam APN 16 52288936 missense probably benign 0.00
IGL02579:Alcam APN 16 52270772 missense probably damaging 1.00
IGL02678:Alcam APN 16 52274038 missense probably damaging 1.00
IGL02798:Alcam APN 16 52305639 missense probably damaging 1.00
IGL02974:Alcam APN 16 52295716 missense probably benign 0.05
IGL03335:Alcam APN 16 52291003 nonsense probably null
PIT4402001:Alcam UTSW 16 52295134 missense probably damaging 1.00
R0282:Alcam UTSW 16 52295741 missense probably damaging 0.99
R0395:Alcam UTSW 16 52309864 missense probably benign 0.42
R0760:Alcam UTSW 16 52295672 missense probably benign 0.32
R0882:Alcam UTSW 16 52253210 missense possibly damaging 0.47
R1433:Alcam UTSW 16 52295752 critical splice acceptor site probably null
R1677:Alcam UTSW 16 52270773 missense probably damaging 1.00
R1751:Alcam UTSW 16 52270714 missense probably damaging 1.00
R1767:Alcam UTSW 16 52270714 missense probably damaging 1.00
R2440:Alcam UTSW 16 52305613 missense probably damaging 1.00
R2963:Alcam UTSW 16 52295041 missense probably benign 0.00
R3410:Alcam UTSW 16 52309898 missense probably null 0.03
R4327:Alcam UTSW 16 52253216 missense possibly damaging 0.62
R4328:Alcam UTSW 16 52253216 missense possibly damaging 0.62
R4888:Alcam UTSW 16 52268813 missense probably benign 0.03
R5088:Alcam UTSW 16 52288927 missense probably damaging 1.00
R5202:Alcam UTSW 16 52274236 missense probably damaging 1.00
R5208:Alcam UTSW 16 52295048 nonsense probably null
R5278:Alcam UTSW 16 52274275 missense probably benign
R5799:Alcam UTSW 16 52309849 missense probably benign 0.28
R5909:Alcam UTSW 16 52290993 missense probably benign
R5960:Alcam UTSW 16 52295126 missense probably benign 0.30
R6194:Alcam UTSW 16 52268398 missense probably damaging 1.00
R6434:Alcam UTSW 16 52288827 splice site probably null
R6831:Alcam UTSW 16 52309901 missense probably benign 0.00
R6868:Alcam UTSW 16 52268385 missense probably damaging 1.00
R6930:Alcam UTSW 16 52305655 missense probably benign 0.14
R6957:Alcam UTSW 16 52276894 missense probably damaging 1.00
R7109:Alcam UTSW 16 52276829 missense probably damaging 0.98
R7473:Alcam UTSW 16 52452519 unclassified probably benign
R7562:Alcam UTSW 16 52268823 missense probably benign 0.00
R7568:Alcam UTSW 16 52268386 missense probably damaging 1.00
R7631:Alcam UTSW 16 52288913 splice site probably null
R8362:Alcam UTSW 16 52295024 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACTGAATGAGGCTTGTGGAG -3'
(R):5'- TCCCTTGTGTAGAAGAGTCAAAAGC -3'

Sequencing Primer
(F):5'- CTGAATGAGGCTTGTGGAGATTTAAG -3'
(R):5'- CTGATTCACTGTCTTGAATGACATC -3'
Posted On2019-06-07