Incidental Mutation 'R0605:Rnf213'
ID 55671
Institutional Source Beutler Lab
Gene Symbol Rnf213
Ensembl Gene ENSMUSG00000070327
Gene Name ring finger protein 213
Synonyms D11Ertd759e
MMRRC Submission 038794-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0605 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 119283926-119378244 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 119322543 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 1387 (T1387A)
Ref Sequence ENSEMBL: ENSMUSP00000115063 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093902] [ENSMUST00000131035]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000093902
AA Change: T1388A

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000091429
Gene: ENSMUSG00000070327
AA Change: T1388A

DomainStartEndE-ValueType
low complexity region 130 146 N/A INTRINSIC
low complexity region 265 279 N/A INTRINSIC
low complexity region 319 335 N/A INTRINSIC
low complexity region 676 688 N/A INTRINSIC
low complexity region 1114 1128 N/A INTRINSIC
low complexity region 1546 1558 N/A INTRINSIC
AAA 2373 2515 2.82e-2 SMART
AAA 2722 2890 3.63e-1 SMART
low complexity region 3449 3459 N/A INTRINSIC
RING 3947 3985 8.69e-5 SMART
Blast:PP2Ac 4544 4722 3e-66 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000131035
AA Change: T1387A

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000115063
Gene: ENSMUSG00000070327
AA Change: T1387A

DomainStartEndE-ValueType
low complexity region 130 146 N/A INTRINSIC
low complexity region 265 279 N/A INTRINSIC
low complexity region 319 335 N/A INTRINSIC
low complexity region 676 688 N/A INTRINSIC
low complexity region 1113 1127 N/A INTRINSIC
low complexity region 1545 1557 N/A INTRINSIC
AAA 2372 2514 2.82e-2 SMART
AAA 2721 2889 3.63e-1 SMART
low complexity region 3448 3458 N/A INTRINSIC
RING 3946 3984 8.69e-5 SMART
Blast:PP2Ac 4542 4720 3e-66 BLAST
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.4%
Validation Efficiency 100% (85/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a C3HC4-type RING finger domain, which is a specialized type of Zn-finger that binds two atoms of zinc and is thought to be involved in mediating protein-protein interactions. The protein also contains an AAA domain, which is associated with ATPase activity. This gene is a susceptibility gene for Moyamoya disease, a vascular disorder of intracranial arteries. This gene is also a translocation partner in anaplastic large cell lymphoma and inflammatory myofibroblastic tumor cases, where a t(2;17)(p23;q25) translocation has been identified with the anaplastic lymphoma kinase (ALK) gene on chromosome 2, and a t(8;17)(q24;q25) translocation has been identified with the MYC gene on chromosome 8. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased body weight and circulating glucose level but normal glucose tolerance, insulin sensitivity, insulin plasma levels and leptin plasma levels. [provided by MGI curators]
Allele List at MGI

All alleles(13) : Targeted, other(2) Gene trapped(11)

Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933406P04Rik G A 10: 20,186,973 (GRCm39) probably benign Het
Adam28 A T 14: 68,844,049 (GRCm39) probably benign Het
Adamts3 A G 5: 90,009,334 (GRCm39) W110R possibly damaging Het
Add1 T C 5: 34,771,568 (GRCm39) V342A possibly damaging Het
Aff3 A G 1: 38,249,068 (GRCm39) S680P probably damaging Het
Ak9 T C 10: 41,221,135 (GRCm39) Y322H probably damaging Het
Als2 A G 1: 59,207,573 (GRCm39) L1528S probably benign Het
Ass1 A T 2: 31,404,831 (GRCm39) N371Y probably damaging Het
Atp6v1a A C 16: 43,931,859 (GRCm39) probably null Het
Bpi T C 2: 158,103,314 (GRCm39) L103P probably damaging Het
Cd80 G A 16: 38,303,056 (GRCm39) V168I probably benign Het
Cfh T C 1: 140,030,096 (GRCm39) S926G probably damaging Het
Chrd A T 16: 20,554,189 (GRCm39) T304S probably damaging Het
Chsy3 A G 18: 59,542,125 (GRCm39) Y421C probably damaging Het
Cmbl T G 15: 31,585,455 (GRCm39) V101G probably damaging Het
Colgalt2 T A 1: 152,371,543 (GRCm39) probably benign Het
Coq4 C T 2: 29,680,010 (GRCm39) Q101* probably null Het
Cr2 T C 1: 194,845,904 (GRCm39) probably benign Het
Cry1 T C 10: 85,020,223 (GRCm39) D38G probably damaging Het
Dmxl2 T C 9: 54,327,229 (GRCm39) D758G probably benign Het
Epsti1 C T 14: 78,164,677 (GRCm39) probably benign Het
Fam24b T C 7: 130,928,915 (GRCm39) probably benign Het
Fem1c G A 18: 46,638,227 (GRCm39) R592C probably benign Het
Foxred1 T C 9: 35,116,178 (GRCm39) Y490C possibly damaging Het
Gm9875 A G 2: 13,562,699 (GRCm39) K9R unknown Het
Grid2ip T C 5: 143,365,117 (GRCm39) S322P probably damaging Het
Gucy1b2 A G 14: 62,640,608 (GRCm39) probably benign Het
Hmcn1 A T 1: 150,533,127 (GRCm39) probably null Het
Hpdl C T 4: 116,677,984 (GRCm39) S159N possibly damaging Het
Hsd17b12 A T 2: 93,863,987 (GRCm39) M285K probably benign Het
Icam5 T C 9: 20,943,493 (GRCm39) I23T probably benign Het
Kat5 A G 19: 5,658,364 (GRCm39) probably benign Het
Lama3 A G 18: 12,640,006 (GRCm39) N67S probably benign Het
Lamb2 T C 9: 108,363,304 (GRCm39) probably benign Het
Lgals3bp A G 11: 118,284,220 (GRCm39) F453S probably damaging Het
Lypd4 A G 7: 24,564,800 (GRCm39) Y113H probably damaging Het
Mdm1 C T 10: 117,982,506 (GRCm39) T47M probably damaging Het
Mei1 C A 15: 81,954,351 (GRCm39) T52K probably benign Het
Meiob G A 17: 25,037,236 (GRCm39) probably benign Het
Ndufaf6 A G 4: 11,051,224 (GRCm39) V292A probably damaging Het
Neb T A 2: 52,154,038 (GRCm39) M2358L possibly damaging Het
Nlrp1b A G 11: 71,047,005 (GRCm39) S1119P possibly damaging Het
Nsmaf A G 4: 6,418,470 (GRCm39) probably null Het
Ogfod1 T C 8: 94,773,895 (GRCm39) probably benign Het
Or5ae2 T C 7: 84,506,345 (GRCm39) I256T probably damaging Het
Or8h7 T C 2: 86,720,763 (GRCm39) Y252C possibly damaging Het
Or9s14 G T 1: 92,535,618 (GRCm39) V20L probably benign Het
Osbpl1a T A 18: 13,015,336 (GRCm39) probably null Het
Otud7b T A 3: 96,052,270 (GRCm39) probably benign Het
P3h3 T A 6: 124,832,998 (GRCm39) H185L probably damaging Het
P4htm G A 9: 108,460,923 (GRCm39) A183V probably null Het
Peak1 C T 9: 56,134,382 (GRCm39) probably benign Het
Phf20l1 A G 15: 66,466,971 (GRCm39) K88R probably damaging Het
Phlpp2 A G 8: 110,659,843 (GRCm39) N721S probably benign Het
Plagl2 T C 2: 153,077,864 (GRCm39) K39R probably benign Het
Plppr1 A T 4: 49,323,466 (GRCm39) N252I probably damaging Het
Pom121l2 C T 13: 22,166,206 (GRCm39) A159V probably damaging Het
Prom2 C A 2: 127,381,915 (GRCm39) probably null Het
Prrc2c T C 1: 162,509,995 (GRCm39) T1017A probably damaging Het
Rimbp3 G T 16: 17,029,563 (GRCm39) A996S probably damaging Het
Scaper A T 9: 55,722,802 (GRCm39) probably benign Het
Scara5 A G 14: 65,997,097 (GRCm39) E403G possibly damaging Het
Scrib T C 15: 75,939,402 (GRCm39) I94V possibly damaging Het
Shank3 T C 15: 89,408,350 (GRCm39) F67L possibly damaging Het
Shprh T C 10: 11,082,856 (GRCm39) F1562L probably damaging Het
Src C T 2: 157,311,841 (GRCm39) T529M probably damaging Het
Sycp2l T A 13: 41,296,942 (GRCm39) M341K probably benign Het
Syde1 T C 10: 78,424,929 (GRCm39) probably benign Het
Tars3 A T 7: 65,327,819 (GRCm39) R509S probably damaging Het
Tle6 T A 10: 81,430,180 (GRCm39) H324L probably damaging Het
Tnfaip8 ACTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC ACTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC 18: 50,179,912 (GRCm39) probably benign Het
Tnfrsf14 T A 4: 155,009,837 (GRCm39) K115* probably null Het
Trappc10 T C 10: 78,037,331 (GRCm39) N824S possibly damaging Het
Tsc1 C T 2: 28,561,790 (GRCm39) S309F probably damaging Het
Ttc21a A G 9: 119,790,908 (GRCm39) I885V possibly damaging Het
Ttn C T 2: 76,570,797 (GRCm39) A26699T probably damaging Het
Ttn T C 2: 76,778,715 (GRCm39) Y1262C unknown Het
Usp49 T C 17: 47,985,851 (GRCm39) probably null Het
Vmn1r226 A T 17: 20,908,133 (GRCm39) T122S probably benign Het
Vps8 A T 16: 21,378,087 (GRCm39) T1033S probably benign Het
Vwf C A 6: 125,662,800 (GRCm39) T2728K probably benign Het
Wdr5b T C 16: 35,862,366 (GRCm39) S162P probably benign Het
Xrn1 C T 9: 95,908,930 (GRCm39) Q1235* probably null Het
Zfp1005 A G 2: 150,110,523 (GRCm39) I404M unknown Het
Other mutations in Rnf213
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Rnf213 APN 11 119,340,169 (GRCm39) missense probably benign 0.00
IGL00961:Rnf213 APN 11 119,331,669 (GRCm39) missense possibly damaging 0.55
IGL01324:Rnf213 APN 11 119,338,063 (GRCm39) missense probably damaging 1.00
IGL01351:Rnf213 APN 11 119,373,944 (GRCm39) missense probably benign 0.25
IGL01403:Rnf213 APN 11 119,334,126 (GRCm39) missense probably damaging 1.00
IGL01704:Rnf213 APN 11 119,340,702 (GRCm39) critical splice donor site probably null
IGL01765:Rnf213 APN 11 119,327,178 (GRCm39) missense probably benign 0.00
IGL01803:Rnf213 APN 11 119,332,133 (GRCm39) missense probably damaging 1.00
IGL01804:Rnf213 APN 11 119,333,092 (GRCm39) missense probably damaging 1.00
IGL01900:Rnf213 APN 11 119,333,841 (GRCm39) missense probably benign 0.05
IGL01944:Rnf213 APN 11 119,307,283 (GRCm39) missense probably benign 0.01
IGL01982:Rnf213 APN 11 119,334,094 (GRCm39) missense probably damaging 1.00
IGL02008:Rnf213 APN 11 119,309,135 (GRCm39) splice site probably benign
IGL02084:Rnf213 APN 11 119,336,499 (GRCm39) missense probably benign 0.04
IGL02253:Rnf213 APN 11 119,331,476 (GRCm39) missense probably benign 0.03
IGL02254:Rnf213 APN 11 119,371,733 (GRCm39) missense possibly damaging 0.89
IGL02296:Rnf213 APN 11 119,354,162 (GRCm39) missense probably benign 0.01
IGL02531:Rnf213 APN 11 119,327,628 (GRCm39) missense probably benign
IGL02588:Rnf213 APN 11 119,307,362 (GRCm39) missense probably benign 0.30
IGL02615:Rnf213 APN 11 119,331,615 (GRCm39) missense probably damaging 0.96
IGL02805:Rnf213 APN 11 119,325,892 (GRCm39) missense probably damaging 0.99
IGL02887:Rnf213 APN 11 119,318,336 (GRCm39) missense probably damaging 1.00
IGL03001:Rnf213 APN 11 119,370,767 (GRCm39) missense probably damaging 1.00
IGL03035:Rnf213 APN 11 119,336,452 (GRCm39) splice site probably benign
IGL03057:Rnf213 APN 11 119,331,913 (GRCm39) missense probably damaging 1.00
IGL03148:Rnf213 APN 11 119,355,833 (GRCm39) missense probably damaging 1.00
IGL03308:Rnf213 APN 11 119,364,998 (GRCm39) missense probably benign 0.03
IGL03339:Rnf213 APN 11 119,333,830 (GRCm39) missense probably damaging 1.00
IGL03369:Rnf213 APN 11 119,312,294 (GRCm39) missense probably benign 0.34
attrition UTSW 11 119,321,147 (GRCm39) missense possibly damaging 0.77
defame UTSW 11 119,321,107 (GRCm39) nonsense probably null
Derogate UTSW 11 119,361,036 (GRCm39) missense probably damaging 1.00
dinky UTSW 11 119,307,284 (GRCm39) missense probably damaging 0.99
G1funyon_rnf213_024 UTSW 11 119,325,568 (GRCm39) missense
Impugn UTSW 11 119,327,649 (GRCm39) nonsense probably null
R4332_Rnf213_642 UTSW 11 119,327,502 (GRCm39) missense probably damaging 1.00
B6584:Rnf213 UTSW 11 119,316,895 (GRCm39) missense probably damaging 0.97
G1Funyon:Rnf213 UTSW 11 119,325,568 (GRCm39) missense
PIT4585001:Rnf213 UTSW 11 119,349,218 (GRCm39) missense
R0008:Rnf213 UTSW 11 119,355,878 (GRCm39) missense possibly damaging 0.82
R0015:Rnf213 UTSW 11 119,332,432 (GRCm39) missense possibly damaging 0.95
R0041:Rnf213 UTSW 11 119,293,401 (GRCm39) missense probably benign 0.41
R0114:Rnf213 UTSW 11 119,305,413 (GRCm39) missense probably damaging 1.00
R0131:Rnf213 UTSW 11 119,321,187 (GRCm39) missense probably benign 0.10
R0131:Rnf213 UTSW 11 119,321,187 (GRCm39) missense probably benign 0.10
R0132:Rnf213 UTSW 11 119,321,187 (GRCm39) missense probably benign 0.10
R0138:Rnf213 UTSW 11 119,307,322 (GRCm39) missense probably benign 0.05
R0144:Rnf213 UTSW 11 119,370,426 (GRCm39) nonsense probably null
R0184:Rnf213 UTSW 11 119,305,347 (GRCm39) missense probably damaging 0.99
R0321:Rnf213 UTSW 11 119,328,931 (GRCm39) nonsense probably null
R0365:Rnf213 UTSW 11 119,316,937 (GRCm39) missense possibly damaging 0.74
R0415:Rnf213 UTSW 11 119,305,295 (GRCm39) missense probably damaging 1.00
R0421:Rnf213 UTSW 11 119,338,083 (GRCm39) missense probably damaging 1.00
R0494:Rnf213 UTSW 11 119,316,838 (GRCm39) missense possibly damaging 0.65
R0494:Rnf213 UTSW 11 119,333,946 (GRCm39) missense probably damaging 1.00
R0549:Rnf213 UTSW 11 119,355,908 (GRCm39) missense probably damaging 1.00
R0577:Rnf213 UTSW 11 119,334,106 (GRCm39) missense probably damaging 1.00
R0638:Rnf213 UTSW 11 119,361,036 (GRCm39) missense probably damaging 1.00
R0675:Rnf213 UTSW 11 119,332,660 (GRCm39) missense probably benign 0.28
R0715:Rnf213 UTSW 11 119,331,976 (GRCm39) missense probably damaging 0.97
R0732:Rnf213 UTSW 11 119,331,894 (GRCm39) missense probably damaging 0.99
R0748:Rnf213 UTSW 11 119,364,306 (GRCm39) missense probably damaging 1.00
R0765:Rnf213 UTSW 11 119,313,921 (GRCm39) critical splice donor site probably null
R0890:Rnf213 UTSW 11 119,321,312 (GRCm39) missense possibly damaging 0.94
R0927:Rnf213 UTSW 11 119,305,396 (GRCm39) missense probably benign 0.00
R0940:Rnf213 UTSW 11 119,307,389 (GRCm39) missense probably benign 0.10
R0959:Rnf213 UTSW 11 119,343,407 (GRCm39) missense probably damaging 0.99
R1077:Rnf213 UTSW 11 119,376,824 (GRCm39) splice site probably benign
R1104:Rnf213 UTSW 11 119,368,055 (GRCm39) missense probably benign 0.29
R1141:Rnf213 UTSW 11 119,326,809 (GRCm39) missense probably benign 0.02
R1219:Rnf213 UTSW 11 119,327,003 (GRCm39) missense probably damaging 1.00
R1435:Rnf213 UTSW 11 119,326,831 (GRCm39) missense probably damaging 1.00
R1444:Rnf213 UTSW 11 119,333,226 (GRCm39) missense probably damaging 1.00
R1474:Rnf213 UTSW 11 119,328,576 (GRCm39) missense probably damaging 1.00
R1488:Rnf213 UTSW 11 119,371,715 (GRCm39) missense probably benign 0.05
R1523:Rnf213 UTSW 11 119,332,714 (GRCm39) missense probably damaging 1.00
R1548:Rnf213 UTSW 11 119,333,533 (GRCm39) missense probably damaging 1.00
R1554:Rnf213 UTSW 11 119,332,665 (GRCm39) missense probably benign 0.06
R1563:Rnf213 UTSW 11 119,305,352 (GRCm39) missense probably benign 0.13
R1572:Rnf213 UTSW 11 119,327,437 (GRCm39) missense probably damaging 1.00
R1585:Rnf213 UTSW 11 119,354,171 (GRCm39) missense probably damaging 1.00
R1635:Rnf213 UTSW 11 119,333,405 (GRCm39) missense probably damaging 0.97
R1663:Rnf213 UTSW 11 119,328,498 (GRCm39) missense probably benign 0.01
R1789:Rnf213 UTSW 11 119,331,047 (GRCm39) missense probably damaging 0.97
R1844:Rnf213 UTSW 11 119,332,009 (GRCm39) missense probably damaging 1.00
R1871:Rnf213 UTSW 11 119,340,955 (GRCm39) missense probably benign 0.08
R1893:Rnf213 UTSW 11 119,307,274 (GRCm39) missense probably damaging 1.00
R1937:Rnf213 UTSW 11 119,322,511 (GRCm39) missense probably damaging 1.00
R1967:Rnf213 UTSW 11 119,371,721 (GRCm39) missense probably damaging 1.00
R1987:Rnf213 UTSW 11 119,331,933 (GRCm39) missense probably damaging 1.00
R2000:Rnf213 UTSW 11 119,326,848 (GRCm39) missense probably damaging 1.00
R2020:Rnf213 UTSW 11 119,352,744 (GRCm39) missense probably damaging 0.99
R2100:Rnf213 UTSW 11 119,358,128 (GRCm39) nonsense probably null
R2109:Rnf213 UTSW 11 119,333,489 (GRCm39) nonsense probably null
R2115:Rnf213 UTSW 11 119,318,839 (GRCm39) missense probably benign 0.00
R2126:Rnf213 UTSW 11 119,341,027 (GRCm39) missense probably damaging 0.99
R2144:Rnf213 UTSW 11 119,334,516 (GRCm39) missense probably damaging 0.99
R2145:Rnf213 UTSW 11 119,306,019 (GRCm39) missense probably benign 0.03
R2168:Rnf213 UTSW 11 119,305,896 (GRCm39) missense probably damaging 0.97
R2189:Rnf213 UTSW 11 119,321,187 (GRCm39) missense probably benign 0.10
R2199:Rnf213 UTSW 11 119,350,835 (GRCm39) missense probably benign 0.01
R2220:Rnf213 UTSW 11 119,327,254 (GRCm39) missense possibly damaging 0.94
R2336:Rnf213 UTSW 11 119,305,430 (GRCm39) missense probably benign 0.02
R2400:Rnf213 UTSW 11 119,334,021 (GRCm39) missense probably damaging 1.00
R2679:Rnf213 UTSW 11 119,350,764 (GRCm39) splice site probably null
R2698:Rnf213 UTSW 11 119,300,970 (GRCm39) missense probably benign 0.26
R3151:Rnf213 UTSW 11 119,359,718 (GRCm39) missense probably benign 0.03
R3607:Rnf213 UTSW 11 119,332,802 (GRCm39) nonsense probably null
R3808:Rnf213 UTSW 11 119,370,384 (GRCm39) missense probably damaging 1.00
R3854:Rnf213 UTSW 11 119,371,765 (GRCm39) splice site probably benign
R3856:Rnf213 UTSW 11 119,371,765 (GRCm39) splice site probably benign
R3973:Rnf213 UTSW 11 119,359,879 (GRCm39) missense
R4014:Rnf213 UTSW 11 119,336,555 (GRCm39) nonsense probably null
R4049:Rnf213 UTSW 11 119,373,274 (GRCm39) missense possibly damaging 0.67
R4130:Rnf213 UTSW 11 119,373,832 (GRCm39) missense probably damaging 1.00
R4153:Rnf213 UTSW 11 119,300,308 (GRCm39) missense probably benign 0.27
R4167:Rnf213 UTSW 11 119,332,069 (GRCm39) missense probably damaging 0.99
R4224:Rnf213 UTSW 11 119,327,649 (GRCm39) nonsense probably null
R4332:Rnf213 UTSW 11 119,327,502 (GRCm39) missense probably damaging 1.00
R4415:Rnf213 UTSW 11 119,374,790 (GRCm39) missense probably damaging 0.99
R4547:Rnf213 UTSW 11 119,370,496 (GRCm39) critical splice donor site probably null
R4609:Rnf213 UTSW 11 119,328,521 (GRCm39) missense possibly damaging 0.86
R4684:Rnf213 UTSW 11 119,331,951 (GRCm39) missense probably damaging 1.00
R4704:Rnf213 UTSW 11 119,331,175 (GRCm39) missense probably damaging 1.00
R4719:Rnf213 UTSW 11 119,310,893 (GRCm39) missense probably benign 0.38
R4751:Rnf213 UTSW 11 119,336,571 (GRCm39) missense probably benign 0.12
R4828:Rnf213 UTSW 11 119,307,455 (GRCm39) missense possibly damaging 0.61
R4837:Rnf213 UTSW 11 119,333,589 (GRCm39) missense probably benign 0.00
R4894:Rnf213 UTSW 11 119,372,066 (GRCm39) missense probably damaging 1.00
R4973:Rnf213 UTSW 11 119,318,983 (GRCm39) missense possibly damaging 0.84
R5026:Rnf213 UTSW 11 119,327,590 (GRCm39) missense probably damaging 1.00
R5034:Rnf213 UTSW 11 119,301,633 (GRCm39) missense probably damaging 0.99
R5284:Rnf213 UTSW 11 119,349,692 (GRCm39) missense possibly damaging 0.89
R5295:Rnf213 UTSW 11 119,331,642 (GRCm39) missense probably benign 0.00
R5406:Rnf213 UTSW 11 119,331,634 (GRCm39) missense probably damaging 1.00
R5441:Rnf213 UTSW 11 119,299,846 (GRCm39) missense probably damaging 0.99
R5449:Rnf213 UTSW 11 119,305,902 (GRCm39) missense probably benign 0.44
R5520:Rnf213 UTSW 11 119,324,325 (GRCm39) missense probably damaging 1.00
R5636:Rnf213 UTSW 11 119,327,731 (GRCm39) missense probably damaging 1.00
R5636:Rnf213 UTSW 11 119,327,455 (GRCm39) missense probably benign 0.04
R5669:Rnf213 UTSW 11 119,349,611 (GRCm39) missense possibly damaging 0.92
R5670:Rnf213 UTSW 11 119,325,512 (GRCm39) critical splice acceptor site probably null
R5697:Rnf213 UTSW 11 119,374,720 (GRCm39) missense possibly damaging 0.54
R5726:Rnf213 UTSW 11 119,307,284 (GRCm39) missense probably damaging 0.99
R5808:Rnf213 UTSW 11 119,327,121 (GRCm39) missense probably benign
R5861:Rnf213 UTSW 11 119,364,203 (GRCm39) missense probably damaging 1.00
R5903:Rnf213 UTSW 11 119,312,195 (GRCm39) missense probably damaging 0.98
R5949:Rnf213 UTSW 11 119,333,905 (GRCm39) missense probably damaging 1.00
R6022:Rnf213 UTSW 11 119,376,836 (GRCm39) missense probably benign 0.00
R6043:Rnf213 UTSW 11 119,332,927 (GRCm39) missense probably damaging 0.97
R6089:Rnf213 UTSW 11 119,307,385 (GRCm39) missense probably benign 0.14
R6123:Rnf213 UTSW 11 119,302,339 (GRCm39) missense probably damaging 0.96
R6134:Rnf213 UTSW 11 119,302,296 (GRCm39) missense probably damaging 0.99
R6135:Rnf213 UTSW 11 119,332,854 (GRCm39) missense probably benign 0.02
R6146:Rnf213 UTSW 11 119,326,825 (GRCm39) missense probably benign 0.41
R6163:Rnf213 UTSW 11 119,349,254 (GRCm39) missense possibly damaging 0.86
R6272:Rnf213 UTSW 11 119,305,374 (GRCm39) missense probably damaging 1.00
R6333:Rnf213 UTSW 11 119,354,192 (GRCm39) missense probably damaging 1.00
R6370:Rnf213 UTSW 11 119,367,904 (GRCm39) missense probably damaging 0.99
R6456:Rnf213 UTSW 11 119,350,792 (GRCm39) missense probably benign 0.03
R6468:Rnf213 UTSW 11 119,343,513 (GRCm39) missense possibly damaging 0.94
R6579:Rnf213 UTSW 11 119,327,106 (GRCm39) missense probably damaging 0.96
R6648:Rnf213 UTSW 11 119,370,746 (GRCm39) missense possibly damaging 0.81
R6727:Rnf213 UTSW 11 119,321,147 (GRCm39) missense possibly damaging 0.77
R6739:Rnf213 UTSW 11 119,333,097 (GRCm39) missense probably damaging 1.00
R6768:Rnf213 UTSW 11 119,333,062 (GRCm39) missense probably damaging 0.99
R6817:Rnf213 UTSW 11 119,353,111 (GRCm39) critical splice donor site probably null
R6820:Rnf213 UTSW 11 119,339,664 (GRCm39) missense probably damaging 1.00
R6841:Rnf213 UTSW 11 119,340,692 (GRCm39) missense probably benign 0.26
R6934:Rnf213 UTSW 11 119,310,893 (GRCm39) missense probably benign 0.38
R7026:Rnf213 UTSW 11 119,370,481 (GRCm39) missense possibly damaging 0.58
R7094:Rnf213 UTSW 11 119,328,430 (GRCm39) splice site probably null
R7170:Rnf213 UTSW 11 119,343,401 (GRCm39) missense
R7185:Rnf213 UTSW 11 119,315,024 (GRCm39) missense
R7239:Rnf213 UTSW 11 119,349,614 (GRCm39) missense
R7258:Rnf213 UTSW 11 119,343,401 (GRCm39) missense
R7259:Rnf213 UTSW 11 119,343,401 (GRCm39) missense
R7260:Rnf213 UTSW 11 119,343,401 (GRCm39) missense
R7273:Rnf213 UTSW 11 119,322,582 (GRCm39) splice site probably null
R7282:Rnf213 UTSW 11 119,328,818 (GRCm39) missense
R7311:Rnf213 UTSW 11 119,307,373 (GRCm39) missense
R7352:Rnf213 UTSW 11 119,334,405 (GRCm39) missense
R7369:Rnf213 UTSW 11 119,321,294 (GRCm39) missense
R7410:Rnf213 UTSW 11 119,325,877 (GRCm39) missense
R7448:Rnf213 UTSW 11 119,372,117 (GRCm39) missense
R7561:Rnf213 UTSW 11 119,332,545 (GRCm39) missense
R7573:Rnf213 UTSW 11 119,349,310 (GRCm39) missense
R7615:Rnf213 UTSW 11 119,358,123 (GRCm39) missense
R7680:Rnf213 UTSW 11 119,370,382 (GRCm39) missense
R7739:Rnf213 UTSW 11 119,301,687 (GRCm39) missense
R7789:Rnf213 UTSW 11 119,361,045 (GRCm39) splice site probably null
R7806:Rnf213 UTSW 11 119,302,371 (GRCm39) missense
R8031:Rnf213 UTSW 11 119,321,107 (GRCm39) nonsense probably null
R8042:Rnf213 UTSW 11 119,332,480 (GRCm39) missense
R8053:Rnf213 UTSW 11 119,293,473 (GRCm39) missense
R8284:Rnf213 UTSW 11 119,318,909 (GRCm39) missense
R8301:Rnf213 UTSW 11 119,325,568 (GRCm39) missense
R8325:Rnf213 UTSW 11 119,321,271 (GRCm39) missense
R8332:Rnf213 UTSW 11 119,374,524 (GRCm39) missense
R8443:Rnf213 UTSW 11 119,340,149 (GRCm39) missense
R8518:Rnf213 UTSW 11 119,353,043 (GRCm39) missense
R8531:Rnf213 UTSW 11 119,365,031 (GRCm39) missense probably benign 0.02
R8670:Rnf213 UTSW 11 119,349,563 (GRCm39) missense
R8675:Rnf213 UTSW 11 119,346,984 (GRCm39) missense
R8690:Rnf213 UTSW 11 119,332,038 (GRCm39) missense
R8690:Rnf213 UTSW 11 119,308,955 (GRCm39) missense
R8714:Rnf213 UTSW 11 119,359,720 (GRCm39) missense
R8802:Rnf213 UTSW 11 119,352,928 (GRCm39) missense
R8861:Rnf213 UTSW 11 119,333,062 (GRCm39) missense
R8886:Rnf213 UTSW 11 119,364,264 (GRCm39) missense
R8893:Rnf213 UTSW 11 119,333,868 (GRCm39) missense
R8937:Rnf213 UTSW 11 119,321,100 (GRCm39) missense possibly damaging 0.94
R8941:Rnf213 UTSW 11 119,305,250 (GRCm39) missense probably damaging 1.00
R8973:Rnf213 UTSW 11 119,352,756 (GRCm39) missense
R8983:Rnf213 UTSW 11 119,321,175 (GRCm39) missense
R9043:Rnf213 UTSW 11 119,349,739 (GRCm39) missense
R9081:Rnf213 UTSW 11 119,357,062 (GRCm39) missense
R9132:Rnf213 UTSW 11 119,374,742 (GRCm39) missense
R9135:Rnf213 UTSW 11 119,299,573 (GRCm39) missense
R9146:Rnf213 UTSW 11 119,334,499 (GRCm39) missense
R9156:Rnf213 UTSW 11 119,331,574 (GRCm39) missense
R9183:Rnf213 UTSW 11 119,318,448 (GRCm39) missense
R9234:Rnf213 UTSW 11 119,340,943 (GRCm39) missense
R9275:Rnf213 UTSW 11 119,326,768 (GRCm39) missense
R9278:Rnf213 UTSW 11 119,326,768 (GRCm39) missense
R9296:Rnf213 UTSW 11 119,334,621 (GRCm39) splice site probably benign
R9350:Rnf213 UTSW 11 119,332,975 (GRCm39) missense
R9366:Rnf213 UTSW 11 119,327,057 (GRCm39) missense
R9413:Rnf213 UTSW 11 119,357,059 (GRCm39) missense
R9444:Rnf213 UTSW 11 119,325,623 (GRCm39) missense
R9464:Rnf213 UTSW 11 119,354,406 (GRCm39) missense
R9605:Rnf213 UTSW 11 119,359,879 (GRCm39) missense
R9649:Rnf213 UTSW 11 119,370,457 (GRCm39) missense
R9651:Rnf213 UTSW 11 119,331,238 (GRCm39) missense
R9664:Rnf213 UTSW 11 119,332,794 (GRCm39) missense
R9696:Rnf213 UTSW 11 119,359,806 (GRCm39) missense
R9710:Rnf213 UTSW 11 119,331,831 (GRCm39) missense
R9797:Rnf213 UTSW 11 119,333,365 (GRCm39) missense
S24628:Rnf213 UTSW 11 119,305,295 (GRCm39) missense probably damaging 1.00
X0021:Rnf213 UTSW 11 119,332,650 (GRCm39) missense probably benign 0.14
X0062:Rnf213 UTSW 11 119,364,339 (GRCm39) missense probably benign 0.05
X0064:Rnf213 UTSW 11 119,331,289 (GRCm39) missense probably damaging 1.00
Z1088:Rnf213 UTSW 11 119,368,080 (GRCm39) missense possibly damaging 0.69
Z1176:Rnf213 UTSW 11 119,373,824 (GRCm39) missense
Z1176:Rnf213 UTSW 11 119,332,236 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- TCCTATGGTCCCTGATGTAAGTGCC -3'
(R):5'- GAGCGAGACACCGTCTGAGTAAAAC -3'

Sequencing Primer
(F):5'- CTGATGTAAGTGCCAGGCTC -3'
(R):5'- CCGTCTGAGTAAAACATGCC -3'
Posted On 2013-07-11