Incidental Mutation 'PIT4651001:Olfr1459'
ID556710
Institutional Source Beutler Lab
Gene Symbol Olfr1459
Ensembl Gene ENSMUSG00000057503
Gene Nameolfactory receptor 1459
SynonymsMOR202-17, GA_x6K02T2RE5P-3473421-3472498
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #PIT4651001 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location13138021-13149549 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 13146627 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 11 (I11F)
Ref Sequence ENSEMBL: ENSMUSP00000150886 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078299] [ENSMUST00000213493]
Predicted Effect probably benign
Transcript: ENSMUST00000078299
AA Change: I11F

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000077414
Gene: ENSMUSG00000057503
AA Change: I11F

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 8e-50 PFAM
Pfam:7tm_1 39 288 1.5e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213493
AA Change: I11F

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
Coding Region Coverage
  • 1x: 93.1%
  • 3x: 90.7%
  • 10x: 84.4%
  • 20x: 70.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A T 13: 77,259,895 I428L probably benign Het
Aass T C 6: 23,118,751 I131V probably benign Het
Alcam T A 16: 52,295,187 K189N probably benign Het
Ankrd50 C A 3: 38,455,810 E803* probably null Het
Ankrd53 A G 6: 83,765,733 D236G probably damaging Het
Bard1 A G 1: 71,074,928 V298A probably benign Het
Cacna1d C T 14: 30,178,645 G361D probably damaging Het
Camkk1 A G 11: 73,025,821 S82G probably benign Het
Ccr4 A T 9: 114,492,193 V268E probably benign Het
Cdh6 G A 15: 13,044,719 S439L possibly damaging Het
Ces1e G T 8: 93,215,083 A254E probably benign Het
Cfap46 T C 7: 139,645,551 T1078A Het
Cyp46a1 A G 12: 108,353,108 D288G probably benign Het
Dnah6 T C 6: 73,060,260 N3333S probably benign Het
Dzip3 A G 16: 48,944,878 V491A probably benign Het
Egr1 G T 18: 34,863,187 E341* probably null Het
Enpp1 G A 10: 24,653,950 P597S probably benign Het
Ercc3 A T 18: 32,240,312 probably benign Het
Fam160a1 C T 3: 85,683,641 A389T probably damaging Het
Fbn1 T C 2: 125,363,989 probably null Het
Fbxw11 T C 11: 32,711,999 probably null Het
Gbf1 A G 19: 46,163,543 N5S probably benign Het
Gbp4 T A 5: 105,118,423 H584L probably benign Het
Gcgr G T 11: 120,538,142 C402F probably damaging Het
Gm3550 A T 18: 34,737,839 Q142L unknown Het
Grm7 T A 6: 110,646,089 N74K probably benign Het
Hils1 A G 11: 94,968,316 S146G probably benign Het
Hoxa10 T G 6: 52,234,897 N13T possibly damaging Het
Ice1 A T 13: 70,623,921 probably null Het
Il22 C A 10: 118,205,590 N69K probably damaging Het
Il9r A T 11: 32,191,798 H319Q probably benign Het
Itgax A G 7: 128,149,110 T1104A probably benign Het
Jag1 C T 2: 137,101,697 G193D probably damaging Het
Krt13 T A 11: 100,120,036 D164V probably damaging Het
Lepr T C 4: 101,791,997 M865T probably damaging Het
Lmf2 G A 15: 89,352,069 H576Y possibly damaging Het
Lrrc8c C T 5: 105,608,323 H655Y probably benign Het
Mapk6 A T 9: 75,397,587 S183T possibly damaging Het
Mcrs1 A T 15: 99,246,951 Y261N probably damaging Het
Mon1b G A 8: 113,638,622 G194D probably benign Het
Myo18b C T 5: 112,834,435 R1144Q probably benign Het
Myo9b T A 8: 71,342,812 H808Q possibly damaging Het
Ngdn T C 14: 55,016,200 I15T probably benign Het
Nhsl1 T G 10: 18,408,435 S41R probably damaging Het
Numa1 A T 7: 102,013,934 K2089M probably damaging Het
Obscn A G 11: 59,041,681 L4900P probably damaging Het
Olfm4 T A 14: 80,021,485 L391Q probably benign Het
Olfr1034 T C 2: 86,046,518 L12P probably damaging Het
Olfr1465 A G 19: 13,314,192 I31T probably benign Het
Olfr705 A G 7: 106,873,523 C241R probably damaging Het
Olfr980 A T 9: 40,006,230 C240S probably damaging Het
Park2 T A 17: 11,067,243 L41Q probably damaging Het
Parn T A 16: 13,631,567 N302Y probably benign Het
Pi4k2b T G 5: 52,748,470 S118A possibly damaging Het
Piwil4 C T 9: 14,708,899 V704I possibly damaging Het
Pm20d2 G A 4: 33,181,715 T296M probably damaging Het
Pmpcb C T 5: 21,746,050 A270V probably benign Het
Pnpt1 T C 11: 29,156,945 probably null Het
Rc3h1 C A 1: 160,963,540 N931K probably benign Het
Rlf A G 4: 121,150,313 V600A probably damaging Het
Rnf219 T A 14: 104,506,256 D129V probably damaging Het
Sall1 T G 8: 89,031,103 Q791P probably damaging Het
Sema3c T A 5: 17,694,733 Y408N probably benign Het
Serpinb13 C T 1: 106,982,844 S66L probably damaging Het
Tmem181a A T 17: 6,300,895 M319L probably benign Het
Trim24 T C 6: 37,900,732 probably null Het
Ttn T A 2: 76,888,934 T7234S unknown Het
Unc13c T A 9: 73,483,739 M2076L possibly damaging Het
Uroc1 C T 6: 90,363,113 R667* probably null Het
Uvrag A G 7: 98,906,520 F456L probably benign Het
Vmn1r215 T C 13: 23,076,360 V190A probably damaging Het
Vmn2r50 T A 7: 10,037,732 T681S probably benign Het
Vmn2r65 T A 7: 84,946,253 T408S probably benign Het
Vps33b A G 7: 80,290,007 D502G probably damaging Het
Other mutations in Olfr1459
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01371:Olfr1459 APN 19 13145828 missense possibly damaging 0.82
IGL01618:Olfr1459 APN 19 13146250 missense probably benign 0.00
IGL01800:Olfr1459 APN 19 13146629 missense probably damaging 1.00
IGL02224:Olfr1459 APN 19 13145756 missense probably damaging 1.00
BB009:Olfr1459 UTSW 19 13145981 missense probably benign 0.10
BB019:Olfr1459 UTSW 19 13145981 missense probably benign 0.10
R0617:Olfr1459 UTSW 19 13146363 missense probably benign 0.28
R2041:Olfr1459 UTSW 19 13146677 start gained probably benign
R2878:Olfr1459 UTSW 19 13146407 missense probably benign 0.38
R3742:Olfr1459 UTSW 19 13145894 missense probably damaging 0.98
R4905:Olfr1459 UTSW 19 13146177 missense probably benign 0.07
R4914:Olfr1459 UTSW 19 13145991 missense possibly damaging 0.64
R4915:Olfr1459 UTSW 19 13145991 missense possibly damaging 0.64
R4916:Olfr1459 UTSW 19 13145991 missense possibly damaging 0.64
R4917:Olfr1459 UTSW 19 13145991 missense possibly damaging 0.64
R4918:Olfr1459 UTSW 19 13145991 missense possibly damaging 0.64
R5367:Olfr1459 UTSW 19 13146501 missense probably damaging 0.98
R6242:Olfr1459 UTSW 19 13146086 missense probably benign 0.05
R6632:Olfr1459 UTSW 19 13146188 missense probably benign 0.02
R6893:Olfr1459 UTSW 19 13145742 missense probably benign 0.00
R7932:Olfr1459 UTSW 19 13145981 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- CCAGCTATGACCTTTGGAGTG -3'
(R):5'- ACAGATTCCAATTCCATCGTTACC -3'

Sequencing Primer
(F):5'- TTGTTGAAGAGTAACAGAAGTCCAC -3'
(R):5'- TGTCAGACAGATCCCATGGTACTG -3'
Posted On2019-06-07