Incidental Mutation 'PIT4802001:Sdr16c5'
ID 556718
Institutional Source Beutler Lab
Gene Symbol Sdr16c5
Ensembl Gene ENSMUSG00000028236
Gene Name short chain dehydrogenase/reductase family 16C, member 5
Synonyms Rdhe2, Scdr9
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock # PIT4802001 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 3995936-4019663 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 4012423 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 123 (I123F)
Ref Sequence ENSEMBL: ENSMUSP00000046298 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040925]
AlphaFold Q7TQA3
Predicted Effect probably damaging
Transcript: ENSMUST00000040925
AA Change: I123F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000046298
Gene: ENSMUSG00000028236
AA Change: I123F

DomainStartEndE-ValueType
Pfam:KR 41 233 1.8e-17 PFAM
Pfam:adh_short 41 238 1.7e-48 PFAM
Pfam:adh_short_C2 47 228 1.3e-12 PFAM
Coding Region Coverage
  • 1x: 93.6%
  • 3x: 91.0%
  • 10x: 85.4%
  • 20x: 73.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the short-chain alcohol dehydrogenase/reductase superfamily of proteins and is involved in the oxidation of retinol to retinaldehyde. The encoded protein is associated with the endoplasmic reticulum and is predicted to contain three transmembrane helices, suggesting that it is an integral membrane protein. It recognizes all-trans-retinol and all-trans-retinaldehyde as substrates and exhibits a strong preference for NAD(+)/NADH as cofactors. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk A T 11: 120,011,346 D741E probably benign Het
Abca16 A G 7: 120,540,128 D1461G probably benign Het
Adam6a G T 12: 113,545,458 D484Y probably damaging Het
Akap5 T C 12: 76,329,932 Y713H probably damaging Het
AW554918 A G 18: 25,340,075 E312G possibly damaging Het
Car4 G A 11: 84,964,405 A157T probably damaging Het
Chst9 A T 18: 15,452,792 M238K probably benign Het
Ctbp2 G A 7: 132,988,245 H397Y possibly damaging Het
Cyp3a59 A G 5: 146,102,801 M295V probably benign Het
Daglb T C 5: 143,503,048 Y586H probably benign Het
Ehbp1l1 G T 19: 5,719,575 P567T possibly damaging Het
Emilin2 A G 17: 71,273,469 I754T probably damaging Het
Esyt2 G A 12: 116,365,837 A672T probably benign Het
Evx1 G T 6: 52,314,190 E116* probably null Het
Exph5 T C 9: 53,374,978 S1120P probably damaging Het
Fam184a A T 10: 53,684,354 L515* probably null Het
Flt4 T A 11: 49,633,169 D525E probably benign Het
Galt T C 4: 41,756,764 W135R probably damaging Het
Ifitm6 A T 7: 141,016,735 C42S probably damaging Het
Ift172 A G 5: 31,285,266 S186P probably benign Het
Kcnk3 A G 5: 30,622,368 E254G probably damaging Het
Kmt2b A G 7: 30,579,571 S1509P probably damaging Het
Ky T A 9: 102,537,773 S295T probably benign Het
Lrba T A 3: 86,664,494 Y2368* probably null Het
Mtmr4 T A 11: 87,611,127 V669E probably benign Het
Myh10 C T 11: 68,765,092 R471C probably damaging Het
Nav1 G A 1: 135,452,933 T1416I unknown Het
Nrip1 A C 16: 76,293,269 S467A probably damaging Het
Ntrk1 T A 3: 87,788,634 N190Y probably damaging Het
Olfr193 A C 16: 59,110,601 M3R probably benign Het
Olfr294 A T 7: 86,616,555 L30Q probably null Het
Pdxp A G 15: 78,918,411 S282G probably damaging Het
Phtf2 A T 5: 20,801,906 S220T probably damaging Het
Piezo2 A T 18: 63,024,469 V2390E probably damaging Het
Pop1 T G 15: 34,529,083 L783R probably benign Het
Prf1 G A 10: 61,300,193 A83T probably benign Het
Rab4b A G 7: 27,175,842 V50A probably benign Het
Rtn1 T A 12: 72,304,326 T370S probably benign Het
Smg6 T A 11: 75,156,165 V1228D probably damaging Het
Smim19 A G 8: 22,473,523 V23A probably benign Het
Sox13 A T 1: 133,386,258 I346N probably damaging Het
Tap1 T A 17: 34,193,191 Y457N probably damaging Het
Tbck C T 3: 132,752,666 P686S probably damaging Het
Tcof1 A G 18: 60,831,938 S570P unknown Het
Tmc5 A T 7: 118,672,226 M921L probably benign Het
Ttc6 A G 12: 57,725,676 Y1594C possibly damaging Het
Virma T A 4: 11,546,008 H1615Q probably damaging Het
Vmn1r19 T A 6: 57,405,052 Y197N probably damaging Het
Vps13c T C 9: 67,937,786 F2051L probably damaging Het
Wdr6 C T 9: 108,574,566 C706Y probably damaging Het
Zfand4 A G 6: 116,284,775 N100D probably damaging Het
Other mutations in Sdr16c5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00547:Sdr16c5 APN 4 4012320 splice site probably benign
IGL02230:Sdr16c5 APN 4 4016354 missense probably damaging 0.99
IGL03090:Sdr16c5 APN 4 4006575 splice site probably benign
R0377:Sdr16c5 UTSW 4 4005546 missense probably benign 0.03
R0610:Sdr16c5 UTSW 4 4016116 missense possibly damaging 0.81
R2012:Sdr16c5 UTSW 4 3996244 missense probably benign
R3735:Sdr16c5 UTSW 4 4005614 missense probably benign
R3839:Sdr16c5 UTSW 4 4006601 missense probably damaging 0.96
R3896:Sdr16c5 UTSW 4 4006609 missense probably damaging 1.00
R4824:Sdr16c5 UTSW 4 4016216 nonsense probably null
R5024:Sdr16c5 UTSW 4 4010365 missense probably damaging 1.00
R5194:Sdr16c5 UTSW 4 4006663 missense probably benign 0.16
R5395:Sdr16c5 UTSW 4 4016277 missense probably benign 0.12
R6267:Sdr16c5 UTSW 4 4016162 missense probably damaging 1.00
R6352:Sdr16c5 UTSW 4 4016421 missense probably benign 0.00
R7076:Sdr16c5 UTSW 4 4006591 missense probably damaging 0.99
R9147:Sdr16c5 UTSW 4 3996200 missense probably benign
R9336:Sdr16c5 UTSW 4 4016108 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGTGTAATGACTGTGTTGATTCC -3'
(R):5'- ATCTAGTGCAGTGAGAACTCTG -3'

Sequencing Primer
(F):5'- ATGACTGTGTTGATTCCTAATCTTC -3'
(R):5'- CAGTGAGAACTCTGCAAAGAGC -3'
Posted On 2019-06-07