Incidental Mutation 'PIT4802001:Galt'
ID556720
Institutional Source Beutler Lab
Gene Symbol Galt
Ensembl Gene ENSMUSG00000036073
Gene Namegalactose-1-phosphate uridyl transferase
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.270) question?
Stock #PIT4802001 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location41755228-41758695 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 41756764 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 135 (W135R)
Ref Sequence ENSEMBL: ENSMUSP00000081745 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084695] [ENSMUST00000098132] [ENSMUST00000108038] [ENSMUST00000108040] [ENSMUST00000108041]
Predicted Effect probably damaging
Transcript: ENSMUST00000084695
AA Change: W135R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000081745
Gene: ENSMUSG00000036073
AA Change: W135R

DomainStartEndE-ValueType
Pfam:GalP_UDP_transf 3 177 1.8e-68 PFAM
Pfam:GalP_UDP_tr_C 183 351 2.1e-69 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000098132
SMART Domains Protein: ENSMUSP00000095736
Gene: ENSMUSG00000073889

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IG 33 108 5.75e-4 SMART
FN3 112 204 2.18e-2 SMART
FN3 218 304 4.93e-1 SMART
low complexity region 354 365 N/A INTRINSIC
transmembrane domain 369 391 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108038
AA Change: W135R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103673
Gene: ENSMUSG00000036073
AA Change: W135R

DomainStartEndE-ValueType
Pfam:GalP_UDP_transf 3 177 3.1e-69 PFAM
Pfam:GalP_UDP_tr_C 183 351 3.8e-61 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108040
SMART Domains Protein: ENSMUSP00000103675
Gene: ENSMUSG00000073889

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IG 33 108 5.75e-4 SMART
FN3 112 204 2.18e-2 SMART
FN3 218 304 4.93e-1 SMART
low complexity region 354 365 N/A INTRINSIC
transmembrane domain 369 391 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108041
SMART Domains Protein: ENSMUSP00000103676
Gene: ENSMUSG00000073889

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IG 33 108 5.75e-4 SMART
FN3 112 204 2.18e-2 SMART
FN3 218 304 4.93e-1 SMART
low complexity region 354 365 N/A INTRINSIC
transmembrane domain 369 391 N/A INTRINSIC
Coding Region Coverage
  • 1x: 93.6%
  • 3x: 91.0%
  • 10x: 85.4%
  • 20x: 73.7%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is the second enzyme in the Leloir pathway, the metabolic pathway for D-galactose catabolism. It catalyzes the conversion of galactose-1-phosphate and uridine diphosphate-glucose to glucose-1-phosphate and uridine diphosphate galactose. Deficiency of this enzyme causes the genetic metabolic disorder galactosemia. Mice lacking this protein accumulate high levels of galactose and galactose-1 phosphate but are viable and fertile. This protein is negatively regulated through signaling by the polypeptide hormone prolactin, specifically via the short isoform of the prolactin receptor and the transcription factor Forkhead box O3. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit abnormal galactose metabolism, but lack symptoms of acute toxicity seen in humans with galactosemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk A T 11: 120,011,346 D741E probably benign Het
Abca16 A G 7: 120,540,128 D1461G probably benign Het
Adam6a G T 12: 113,545,458 D484Y probably damaging Het
Akap5 T C 12: 76,329,932 Y713H probably damaging Het
AW554918 A G 18: 25,340,075 E312G possibly damaging Het
Car4 G A 11: 84,964,405 A157T probably damaging Het
Chst9 A T 18: 15,452,792 M238K probably benign Het
Ctbp2 G A 7: 132,988,245 H397Y possibly damaging Het
Cyp3a59 A G 5: 146,102,801 M295V probably benign Het
Daglb T C 5: 143,503,048 Y586H probably benign Het
Ehbp1l1 G T 19: 5,719,575 P567T possibly damaging Het
Emilin2 A G 17: 71,273,469 I754T probably damaging Het
Esyt2 G A 12: 116,365,837 A672T probably benign Het
Evx1 G T 6: 52,314,190 E116* probably null Het
Exph5 T C 9: 53,374,978 S1120P probably damaging Het
Fam184a A T 10: 53,684,354 L515* probably null Het
Flt4 T A 11: 49,633,169 D525E probably benign Het
Ifitm6 A T 7: 141,016,735 C42S probably damaging Het
Ift172 A G 5: 31,285,266 S186P probably benign Het
Kcnk3 A G 5: 30,622,368 E254G probably damaging Het
Kmt2b A G 7: 30,579,571 S1509P probably damaging Het
Ky T A 9: 102,537,773 S295T probably benign Het
Lrba T A 3: 86,664,494 Y2368* probably null Het
Mtmr4 T A 11: 87,611,127 V669E probably benign Het
Myh10 C T 11: 68,765,092 R471C probably damaging Het
Nav1 G A 1: 135,452,933 T1416I unknown Het
Nrip1 A C 16: 76,293,269 S467A probably damaging Het
Ntrk1 T A 3: 87,788,634 N190Y probably damaging Het
Olfr193 A C 16: 59,110,601 M3R probably benign Het
Olfr294 A T 7: 86,616,555 L30Q probably null Het
Pdxp A G 15: 78,918,411 S282G probably damaging Het
Phtf2 A T 5: 20,801,906 S220T probably damaging Het
Piezo2 A T 18: 63,024,469 V2390E probably damaging Het
Pop1 T G 15: 34,529,083 L783R probably benign Het
Prf1 G A 10: 61,300,193 A83T probably benign Het
Rab4b A G 7: 27,175,842 V50A probably benign Het
Rtn1 T A 12: 72,304,326 T370S probably benign Het
Sdr16c5 T A 4: 4,012,423 I123F probably damaging Het
Smg6 T A 11: 75,156,165 V1228D probably damaging Het
Smim19 A G 8: 22,473,523 V23A probably benign Het
Sox13 A T 1: 133,386,258 I346N probably damaging Het
Tap1 T A 17: 34,193,191 Y457N probably damaging Het
Tbck C T 3: 132,752,666 P686S probably damaging Het
Tcof1 A G 18: 60,831,938 S570P unknown Het
Tmc5 A T 7: 118,672,226 M921L probably benign Het
Ttc6 A G 12: 57,725,676 Y1594C possibly damaging Het
Virma T A 4: 11,546,008 H1615Q probably damaging Het
Vmn1r19 T A 6: 57,405,052 Y197N probably damaging Het
Vps13c T C 9: 67,937,786 F2051L probably damaging Het
Wdr6 C T 9: 108,574,566 C706Y probably damaging Het
Zfand4 A G 6: 116,284,775 N100D probably damaging Het
Other mutations in Galt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00820:Galt APN 4 41758570 missense probably benign 0.02
IGL01150:Galt APN 4 41757786 unclassified probably benign
IGL01525:Galt APN 4 41756068 missense probably benign 0.06
IGL01720:Galt APN 4 41757463 missense probably damaging 1.00
IGL02247:Galt APN 4 41755623 intron probably benign
IGL02576:Galt APN 4 41755953 intron probably benign
R1726:Galt UTSW 4 41756001 nonsense probably null
R2085:Galt UTSW 4 41758162 missense probably damaging 1.00
R2112:Galt UTSW 4 41758245 missense probably benign
R4783:Galt UTSW 4 41758189 missense probably damaging 0.99
R6031:Galt UTSW 4 41757202 missense probably benign 0.01
R6031:Galt UTSW 4 41757202 missense probably benign 0.01
R6171:Galt UTSW 4 41757541 missense probably damaging 1.00
R6357:Galt UTSW 4 41757565 missense probably benign 0.00
R7233:Galt UTSW 4 41758267 missense probably benign 0.04
R7410:Galt UTSW 4 41757707 missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- CAGGTCTGAAGACGAAGACC -3'
(R):5'- TCACATACTTGCCTGGCAGTG -3'

Sequencing Primer
(F):5'- TCTGAAGACGAAGACCTGAGCTTG -3'
(R):5'- GGGTTAGAACAGCCCATCATG -3'
Posted On2019-06-07