Incidental Mutation 'PIT4802001:Vmn1r19'
ID556727
Institutional Source Beutler Lab
Gene Symbol Vmn1r19
Ensembl Gene ENSMUSG00000115799
Gene Namevomeronasal 1 receptor 19
SynonymsV1rc27
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.126) question?
Stock #PIT4802001 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location57403780-57406034 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 57405052 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 197 (Y197N)
Ref Sequence ENSEMBL: ENSMUSP00000087264 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089830]
Predicted Effect probably damaging
Transcript: ENSMUST00000089830
AA Change: Y197N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000087264
Gene: ENSMUSG00000115799
AA Change: Y197N

DomainStartEndE-ValueType
Pfam:V1R 28 293 6.6e-58 PFAM
Coding Region Coverage
  • 1x: 93.6%
  • 3x: 91.0%
  • 10x: 85.4%
  • 20x: 73.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk A T 11: 120,011,346 D741E probably benign Het
Abca16 A G 7: 120,540,128 D1461G probably benign Het
Adam6a G T 12: 113,545,458 D484Y probably damaging Het
Akap5 T C 12: 76,329,932 Y713H probably damaging Het
AW554918 A G 18: 25,340,075 E312G possibly damaging Het
Car4 G A 11: 84,964,405 A157T probably damaging Het
Chst9 A T 18: 15,452,792 M238K probably benign Het
Ctbp2 G A 7: 132,988,245 H397Y possibly damaging Het
Cyp3a59 A G 5: 146,102,801 M295V probably benign Het
Daglb T C 5: 143,503,048 Y586H probably benign Het
Ehbp1l1 G T 19: 5,719,575 P567T possibly damaging Het
Emilin2 A G 17: 71,273,469 I754T probably damaging Het
Esyt2 G A 12: 116,365,837 A672T probably benign Het
Evx1 G T 6: 52,314,190 E116* probably null Het
Exph5 T C 9: 53,374,978 S1120P probably damaging Het
Fam184a A T 10: 53,684,354 L515* probably null Het
Flt4 T A 11: 49,633,169 D525E probably benign Het
Galt T C 4: 41,756,764 W135R probably damaging Het
Ifitm6 A T 7: 141,016,735 C42S probably damaging Het
Ift172 A G 5: 31,285,266 S186P probably benign Het
Kcnk3 A G 5: 30,622,368 E254G probably damaging Het
Kmt2b A G 7: 30,579,571 S1509P probably damaging Het
Ky T A 9: 102,537,773 S295T probably benign Het
Lrba T A 3: 86,664,494 Y2368* probably null Het
Mtmr4 T A 11: 87,611,127 V669E probably benign Het
Myh10 C T 11: 68,765,092 R471C probably damaging Het
Nav1 G A 1: 135,452,933 T1416I unknown Het
Nrip1 A C 16: 76,293,269 S467A probably damaging Het
Ntrk1 T A 3: 87,788,634 N190Y probably damaging Het
Olfr193 A C 16: 59,110,601 M3R probably benign Het
Olfr294 A T 7: 86,616,555 L30Q probably null Het
Pdxp A G 15: 78,918,411 S282G probably damaging Het
Phtf2 A T 5: 20,801,906 S220T probably damaging Het
Piezo2 A T 18: 63,024,469 V2390E probably damaging Het
Pop1 T G 15: 34,529,083 L783R probably benign Het
Prf1 G A 10: 61,300,193 A83T probably benign Het
Rab4b A G 7: 27,175,842 V50A probably benign Het
Rtn1 T A 12: 72,304,326 T370S probably benign Het
Sdr16c5 T A 4: 4,012,423 I123F probably damaging Het
Smg6 T A 11: 75,156,165 V1228D probably damaging Het
Smim19 A G 8: 22,473,523 V23A probably benign Het
Sox13 A T 1: 133,386,258 I346N probably damaging Het
Tap1 T A 17: 34,193,191 Y457N probably damaging Het
Tbck C T 3: 132,752,666 P686S probably damaging Het
Tcof1 A G 18: 60,831,938 S570P unknown Het
Tmc5 A T 7: 118,672,226 M921L probably benign Het
Ttc6 A G 12: 57,725,676 Y1594C possibly damaging Het
Virma T A 4: 11,546,008 H1615Q probably damaging Het
Vps13c T C 9: 67,937,786 F2051L probably damaging Het
Wdr6 C T 9: 108,574,566 C706Y probably damaging Het
Zfand4 A G 6: 116,284,775 N100D probably damaging Het
Other mutations in Vmn1r19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00948:Vmn1r19 APN 6 57405262 missense probably benign 0.03
IGL01287:Vmn1r19 APN 6 57405194 missense probably damaging 1.00
IGL01516:Vmn1r19 APN 6 57404872 missense probably benign 0.03
IGL01895:Vmn1r19 APN 6 57405260 missense probably benign 0.02
IGL02676:Vmn1r19 APN 6 57405040 missense possibly damaging 0.94
IGL03040:Vmn1r19 APN 6 57405362 missense unknown
IGL03087:Vmn1r19 APN 6 57404491 missense probably benign 0.01
R0319:Vmn1r19 UTSW 6 57404615 missense possibly damaging 0.93
R1368:Vmn1r19 UTSW 6 57404671 missense probably benign 0.01
R1997:Vmn1r19 UTSW 6 57405048 missense probably damaging 1.00
R2920:Vmn1r19 UTSW 6 57404924 missense probably benign 0.03
R3857:Vmn1r19 UTSW 6 57405113 missense possibly damaging 0.68
R4090:Vmn1r19 UTSW 6 57404735 missense probably damaging 1.00
R4547:Vmn1r19 UTSW 6 57404789 missense possibly damaging 0.56
R4823:Vmn1r19 UTSW 6 57405234 nonsense probably null
R4951:Vmn1r19 UTSW 6 57404942 missense probably benign 0.36
R5077:Vmn1r19 UTSW 6 57405041 missense probably benign 0.00
R5459:Vmn1r19 UTSW 6 57404490 nonsense probably null
R5625:Vmn1r19 UTSW 6 57405296 missense probably damaging 1.00
R5690:Vmn1r19 UTSW 6 57404795 missense probably benign 0.10
R5761:Vmn1r19 UTSW 6 57405353 missense unknown
R6124:Vmn1r19 UTSW 6 57404617 missense probably benign 0.02
R6373:Vmn1r19 UTSW 6 57405332 missense unknown
R6476:Vmn1r19 UTSW 6 57404593 missense probably damaging 0.99
R6938:Vmn1r19 UTSW 6 57405007 missense possibly damaging 0.94
R7027:Vmn1r19 UTSW 6 57404490 nonsense probably null
R7359:Vmn1r19 UTSW 6 57405095 missense probably damaging 0.99
R7568:Vmn1r19 UTSW 6 57404828 missense possibly damaging 0.69
R7893:Vmn1r19 UTSW 6 57404679 missense probably damaging 1.00
R7976:Vmn1r19 UTSW 6 57404679 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTCCCAGTACCTCTTTGTTGG -3'
(R):5'- TCCAAAACAGGGTTGAGGTG -3'

Sequencing Primer
(F):5'- TCATTCAGTAGTAGGTGGATCTTC -3'
(R):5'- TGAATGAGATGATGAAGTCCACCC -3'
Posted On2019-06-07