Incidental Mutation 'PIT4802001:Zfand4'
ID556728
Institutional Source Beutler Lab
Gene Symbol Zfand4
Ensembl Gene ENSMUSG00000042213
Gene Namezinc finger, AN1-type domain 4
SynonymsAnubl1, 2810002D23Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.194) question?
Stock #PIT4802001 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location116264222-116330302 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 116284775 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 100 (N100D)
Ref Sequence ENSEMBL: ENSMUSP00000108521 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036503] [ENSMUST00000112900] [ENSMUST00000220845] [ENSMUST00000221069] [ENSMUST00000222494] [ENSMUST00000222819] [ENSMUST00000223495]
Predicted Effect
SMART Domains Protein: ENSMUSP00000040057
Gene: ENSMUSG00000042213
AA Change: N100D

DomainStartEndE-ValueType
low complexity region 118 151 N/A INTRINSIC
low complexity region 458 472 N/A INTRINSIC
ZnF_AN1 554 592 4.18e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112900
AA Change: N100D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108521
Gene: ENSMUSG00000042213
AA Change: N100D

DomainStartEndE-ValueType
UBQ 54 125 4.11e-15 SMART
low complexity region 262 295 N/A INTRINSIC
low complexity region 602 616 N/A INTRINSIC
ZnF_AN1 698 736 4.18e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000220845
Predicted Effect probably benign
Transcript: ENSMUST00000221069
Predicted Effect probably benign
Transcript: ENSMUST00000222494
Predicted Effect probably benign
Transcript: ENSMUST00000222819
Predicted Effect probably benign
Transcript: ENSMUST00000223495
AA Change: N100D

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
Coding Region Coverage
  • 1x: 93.6%
  • 3x: 91.0%
  • 10x: 85.4%
  • 20x: 73.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk A T 11: 120,011,346 D741E probably benign Het
Abca16 A G 7: 120,540,128 D1461G probably benign Het
Adam6a G T 12: 113,545,458 D484Y probably damaging Het
Akap5 T C 12: 76,329,932 Y713H probably damaging Het
AW554918 A G 18: 25,340,075 E312G possibly damaging Het
Car4 G A 11: 84,964,405 A157T probably damaging Het
Chst9 A T 18: 15,452,792 M238K probably benign Het
Ctbp2 G A 7: 132,988,245 H397Y possibly damaging Het
Cyp3a59 A G 5: 146,102,801 M295V probably benign Het
Daglb T C 5: 143,503,048 Y586H probably benign Het
Ehbp1l1 G T 19: 5,719,575 P567T possibly damaging Het
Emilin2 A G 17: 71,273,469 I754T probably damaging Het
Esyt2 G A 12: 116,365,837 A672T probably benign Het
Evx1 G T 6: 52,314,190 E116* probably null Het
Exph5 T C 9: 53,374,978 S1120P probably damaging Het
Fam184a A T 10: 53,684,354 L515* probably null Het
Flt4 T A 11: 49,633,169 D525E probably benign Het
Galt T C 4: 41,756,764 W135R probably damaging Het
Ifitm6 A T 7: 141,016,735 C42S probably damaging Het
Ift172 A G 5: 31,285,266 S186P probably benign Het
Kcnk3 A G 5: 30,622,368 E254G probably damaging Het
Kmt2b A G 7: 30,579,571 S1509P probably damaging Het
Ky T A 9: 102,537,773 S295T probably benign Het
Lrba T A 3: 86,664,494 Y2368* probably null Het
Mtmr4 T A 11: 87,611,127 V669E probably benign Het
Myh10 C T 11: 68,765,092 R471C probably damaging Het
Nav1 G A 1: 135,452,933 T1416I unknown Het
Nrip1 A C 16: 76,293,269 S467A probably damaging Het
Ntrk1 T A 3: 87,788,634 N190Y probably damaging Het
Olfr193 A C 16: 59,110,601 M3R probably benign Het
Olfr294 A T 7: 86,616,555 L30Q probably null Het
Pdxp A G 15: 78,918,411 S282G probably damaging Het
Phtf2 A T 5: 20,801,906 S220T probably damaging Het
Piezo2 A T 18: 63,024,469 V2390E probably damaging Het
Pop1 T G 15: 34,529,083 L783R probably benign Het
Prf1 G A 10: 61,300,193 A83T probably benign Het
Rab4b A G 7: 27,175,842 V50A probably benign Het
Rtn1 T A 12: 72,304,326 T370S probably benign Het
Sdr16c5 T A 4: 4,012,423 I123F probably damaging Het
Smg6 T A 11: 75,156,165 V1228D probably damaging Het
Smim19 A G 8: 22,473,523 V23A probably benign Het
Sox13 A T 1: 133,386,258 I346N probably damaging Het
Tap1 T A 17: 34,193,191 Y457N probably damaging Het
Tbck C T 3: 132,752,666 P686S probably damaging Het
Tcof1 A G 18: 60,831,938 S570P unknown Het
Tmc5 A T 7: 118,672,226 M921L probably benign Het
Ttc6 A G 12: 57,725,676 Y1594C possibly damaging Het
Virma T A 4: 11,546,008 H1615Q probably damaging Het
Vmn1r19 T A 6: 57,405,052 Y197N probably damaging Het
Vps13c T C 9: 67,937,786 F2051L probably damaging Het
Wdr6 C T 9: 108,574,566 C706Y probably damaging Het
Other mutations in Zfand4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01415:Zfand4 APN 6 116314869 missense probably benign 0.14
IGL02001:Zfand4 APN 6 116273652 missense probably benign 0.11
IGL02047:Zfand4 APN 6 116314928 missense probably damaging 1.00
IGL02887:Zfand4 APN 6 116273656 missense possibly damaging 0.66
IGL02943:Zfand4 APN 6 116273876 splice site probably benign
IGL03058:Zfand4 APN 6 116288077 missense probably benign 0.03
IGL03130:Zfand4 APN 6 116273659 missense probably damaging 0.99
IGL03253:Zfand4 APN 6 116284809 missense probably damaging 1.00
R0015:Zfand4 UTSW 6 116328297 missense probably damaging 1.00
R0133:Zfand4 UTSW 6 116314739 missense probably benign 0.02
R0446:Zfand4 UTSW 6 116288054 missense probably benign 0.29
R0508:Zfand4 UTSW 6 116285867 missense probably damaging 1.00
R1385:Zfand4 UTSW 6 116273638 missense probably damaging 1.00
R1577:Zfand4 UTSW 6 116329412 nonsense probably null
R2179:Zfand4 UTSW 6 116314781 missense possibly damaging 0.92
R3862:Zfand4 UTSW 6 116293815 intron probably benign
R4607:Zfand4 UTSW 6 116328234 nonsense probably null
R4608:Zfand4 UTSW 6 116328234 nonsense probably null
R4720:Zfand4 UTSW 6 116288161 critical splice donor site probably null
R4724:Zfand4 UTSW 6 116273819 missense probably damaging 1.00
R4771:Zfand4 UTSW 6 116314350 missense probably damaging 1.00
R5541:Zfand4 UTSW 6 116314295 missense possibly damaging 0.50
R5721:Zfand4 UTSW 6 116287995 missense probably damaging 1.00
R5901:Zfand4 UTSW 6 116288123 missense probably damaging 0.99
R6253:Zfand4 UTSW 6 116273614 missense probably damaging 0.97
R6798:Zfand4 UTSW 6 116328253 missense probably benign 0.01
R7030:Zfand4 UTSW 6 116305657 missense probably benign 0.01
R7081:Zfand4 UTSW 6 116315620 missense possibly damaging 0.71
R7082:Zfand4 UTSW 6 116328376 intron probably null
Z1176:Zfand4 UTSW 6 116313921 missense probably damaging 0.98
Z1177:Zfand4 UTSW 6 116313921 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ATAGTGGTGCCAGCCATACATC -3'
(R):5'- GAATTCACAATGACACCTGGG -3'

Sequencing Primer
(F):5'- CCATACATCGAAGAAGACAGCTGTTG -3'
(R):5'- ACCTGGGATCAGAGAGCTGTTC -3'
Posted On2019-06-07