Incidental Mutation 'PIT4802001:Olfr294'
ID556731
Institutional Source Beutler Lab
Gene Symbol Olfr294
Ensembl Gene ENSMUSG00000062042
Gene Nameolfactory receptor 294
SynonymsGA_x6K02T2NHDJ-9504525-9505532, MOR219-5
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #PIT4802001 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location86615636-86616643 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 86616555 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 30 (L30Q)
Ref Sequence ENSEMBL: ENSMUSP00000077662 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078588]
Predicted Effect probably null
Transcript: ENSMUST00000078588
AA Change: L30Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077662
Gene: ENSMUSG00000062042
AA Change: L30Q

DomainStartEndE-ValueType
Pfam:7tm_4 29 309 1.2e-38 PFAM
Pfam:7tm_1 39 288 1.8e-22 PFAM
Coding Region Coverage
  • 1x: 93.6%
  • 3x: 91.0%
  • 10x: 85.4%
  • 20x: 73.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk A T 11: 120,011,346 D741E probably benign Het
Abca16 A G 7: 120,540,128 D1461G probably benign Het
Adam6a G T 12: 113,545,458 D484Y probably damaging Het
Akap5 T C 12: 76,329,932 Y713H probably damaging Het
AW554918 A G 18: 25,340,075 E312G possibly damaging Het
Car4 G A 11: 84,964,405 A157T probably damaging Het
Chst9 A T 18: 15,452,792 M238K probably benign Het
Ctbp2 G A 7: 132,988,245 H397Y possibly damaging Het
Cyp3a59 A G 5: 146,102,801 M295V probably benign Het
Daglb T C 5: 143,503,048 Y586H probably benign Het
Ehbp1l1 G T 19: 5,719,575 P567T possibly damaging Het
Emilin2 A G 17: 71,273,469 I754T probably damaging Het
Esyt2 G A 12: 116,365,837 A672T probably benign Het
Evx1 G T 6: 52,314,190 E116* probably null Het
Exph5 T C 9: 53,374,978 S1120P probably damaging Het
Fam184a A T 10: 53,684,354 L515* probably null Het
Flt4 T A 11: 49,633,169 D525E probably benign Het
Galt T C 4: 41,756,764 W135R probably damaging Het
Ifitm6 A T 7: 141,016,735 C42S probably damaging Het
Ift172 A G 5: 31,285,266 S186P probably benign Het
Kcnk3 A G 5: 30,622,368 E254G probably damaging Het
Kmt2b A G 7: 30,579,571 S1509P probably damaging Het
Ky T A 9: 102,537,773 S295T probably benign Het
Lrba T A 3: 86,664,494 Y2368* probably null Het
Mtmr4 T A 11: 87,611,127 V669E probably benign Het
Myh10 C T 11: 68,765,092 R471C probably damaging Het
Nav1 G A 1: 135,452,933 T1416I unknown Het
Nrip1 A C 16: 76,293,269 S467A probably damaging Het
Ntrk1 T A 3: 87,788,634 N190Y probably damaging Het
Olfr193 A C 16: 59,110,601 M3R probably benign Het
Pdxp A G 15: 78,918,411 S282G probably damaging Het
Phtf2 A T 5: 20,801,906 S220T probably damaging Het
Piezo2 A T 18: 63,024,469 V2390E probably damaging Het
Pop1 T G 15: 34,529,083 L783R probably benign Het
Prf1 G A 10: 61,300,193 A83T probably benign Het
Rab4b A G 7: 27,175,842 V50A probably benign Het
Rtn1 T A 12: 72,304,326 T370S probably benign Het
Sdr16c5 T A 4: 4,012,423 I123F probably damaging Het
Smg6 T A 11: 75,156,165 V1228D probably damaging Het
Smim19 A G 8: 22,473,523 V23A probably benign Het
Sox13 A T 1: 133,386,258 I346N probably damaging Het
Tap1 T A 17: 34,193,191 Y457N probably damaging Het
Tbck C T 3: 132,752,666 P686S probably damaging Het
Tcof1 A G 18: 60,831,938 S570P unknown Het
Tmc5 A T 7: 118,672,226 M921L probably benign Het
Ttc6 A G 12: 57,725,676 Y1594C possibly damaging Het
Virma T A 4: 11,546,008 H1615Q probably damaging Het
Vmn1r19 T A 6: 57,405,052 Y197N probably damaging Het
Vps13c T C 9: 67,937,786 F2051L probably damaging Het
Wdr6 C T 9: 108,574,566 C706Y probably damaging Het
Zfand4 A G 6: 116,284,775 N100D probably damaging Het
Other mutations in Olfr294
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01365:Olfr294 APN 7 86615997 missense probably damaging 1.00
IGL02617:Olfr294 APN 7 86615664 missense probably benign 0.14
IGL02694:Olfr294 APN 7 86616310 missense probably benign 0.00
IGL02828:Olfr294 APN 7 86616069 missense possibly damaging 0.67
IGL03229:Olfr294 APN 7 86616078 missense probably benign 0.00
IGL03351:Olfr294 APN 7 86615677 missense possibly damaging 0.68
R0848:Olfr294 UTSW 7 86615640 missense probably damaging 0.96
R1448:Olfr294 UTSW 7 86616361 missense probably damaging 1.00
R1720:Olfr294 UTSW 7 86616456 missense probably damaging 1.00
R1734:Olfr294 UTSW 7 86616217 missense probably benign 0.07
R1959:Olfr294 UTSW 7 86616431 missense probably benign 0.00
R2116:Olfr294 UTSW 7 86616078 missense probably benign 0.00
R2518:Olfr294 UTSW 7 86616187 missense probably benign 0.03
R3034:Olfr294 UTSW 7 86615762 missense possibly damaging 0.50
R3110:Olfr294 UTSW 7 86615676 missense probably benign
R3112:Olfr294 UTSW 7 86615676 missense probably benign
R3690:Olfr294 UTSW 7 86616478 missense probably damaging 1.00
R4612:Olfr294 UTSW 7 86615736 missense probably benign 0.00
R6476:Olfr294 UTSW 7 86616010 missense probably benign 0.04
R6895:Olfr294 UTSW 7 86616115 missense probably damaging 1.00
R7102:Olfr294 UTSW 7 86616267 missense probably benign 0.25
R7104:Olfr294 UTSW 7 86615692 missense probably null 0.07
R7179:Olfr294 UTSW 7 86616366 missense possibly damaging 0.76
R7256:Olfr294 UTSW 7 86615665 missense probably benign 0.03
R7624:Olfr294 UTSW 7 86616561 missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- AACAATTGGAGGGCACAACC -3'
(R):5'- GGGCAGTATCTAGGTAGTGTCC -3'

Sequencing Primer
(F):5'- GGCACAACCCAGAATAGAAATTG -3'
(R):5'- CTGGGTCCATTTCCACTGAG -3'
Posted On2019-06-07