Incidental Mutation 'PIT4802001:Abca16'
ID 556733
Institutional Source Beutler Lab
Gene Symbol Abca16
Ensembl Gene ENSMUSG00000051900
Gene Name ATP-binding cassette, sub-family A (ABC1), member 16
Synonyms
Accession Numbers

NCBI RefSeq: NM_001278943.1, NM_001278944.1; MGI:2388711

Essential gene? Non essential (E-score: 0.000) question?
Stock # PIT4802001 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 120409647-120544813 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 120540128 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 1461 (D1461G)
Ref Sequence ENSEMBL: ENSMUSP00000112736 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056042] [ENSMUST00000120490]
AlphaFold E9PWJ7
Predicted Effect possibly damaging
Transcript: ENSMUST00000056042
AA Change: D1460G

PolyPhen 2 Score 0.611 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000061094
Gene: ENSMUSG00000051900
AA Change: D1460G

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 26 455 2.7e-23 PFAM
AAA 537 720 2.01e-7 SMART
Pfam:ABC2_membrane_3 898 1287 4.6e-25 PFAM
low complexity region 1325 1336 N/A INTRINSIC
low complexity region 1342 1353 N/A INTRINSIC
AAA 1378 1563 4.23e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120490
AA Change: D1461G

PolyPhen 2 Score 0.305 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000112736
Gene: ENSMUSG00000051900
AA Change: D1461G

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 25 456 2.4e-22 PFAM
AAA 538 721 2.01e-7 SMART
Pfam:ABC2_membrane_3 899 1288 1.1e-27 PFAM
low complexity region 1326 1337 N/A INTRINSIC
low complexity region 1343 1354 N/A INTRINSIC
AAA 1379 1564 4.23e-6 SMART
Coding Region Coverage
  • 1x: 93.6%
  • 3x: 91.0%
  • 10x: 85.4%
  • 20x: 73.7%
Validation Efficiency
Allele List at MGI

All alleles(4) : Targeted(3) Gene trapped(1

Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk A T 11: 120,011,346 (GRCm38) D741E probably benign Het
Adam6a G T 12: 113,545,458 (GRCm38) D484Y probably damaging Het
Akap5 T C 12: 76,329,932 (GRCm38) Y713H probably damaging Het
AW554918 A G 18: 25,340,075 (GRCm38) E312G possibly damaging Het
Car4 G A 11: 84,964,405 (GRCm38) A157T probably damaging Het
Chst9 A T 18: 15,452,792 (GRCm38) M238K probably benign Het
Ctbp2 G A 7: 132,988,245 (GRCm38) H397Y possibly damaging Het
Cyp3a59 A G 5: 146,102,801 (GRCm38) M295V probably benign Het
Daglb T C 5: 143,503,048 (GRCm38) Y586H probably benign Het
Ehbp1l1 G T 19: 5,719,575 (GRCm38) P567T possibly damaging Het
Emilin2 A G 17: 71,273,469 (GRCm38) I754T probably damaging Het
Esyt2 G A 12: 116,365,837 (GRCm38) A672T probably benign Het
Evx1 G T 6: 52,314,190 (GRCm38) E116* probably null Het
Exph5 T C 9: 53,374,978 (GRCm38) S1120P probably damaging Het
Fam184a A T 10: 53,684,354 (GRCm38) L515* probably null Het
Flt4 T A 11: 49,633,169 (GRCm38) D525E probably benign Het
Galt T C 4: 41,756,764 (GRCm38) W135R probably damaging Het
Ifitm6 A T 7: 141,016,735 (GRCm38) C42S probably damaging Het
Ift172 A G 5: 31,285,266 (GRCm38) S186P probably benign Het
Kcnk3 A G 5: 30,622,368 (GRCm38) E254G probably damaging Het
Kmt2b A G 7: 30,579,571 (GRCm38) S1509P probably damaging Het
Ky T A 9: 102,537,773 (GRCm38) S295T probably benign Het
Lrba T A 3: 86,664,494 (GRCm38) Y2368* probably null Het
Mtmr4 T A 11: 87,611,127 (GRCm38) V669E probably benign Het
Myh10 C T 11: 68,765,092 (GRCm38) R471C probably damaging Het
Nav1 G A 1: 135,452,933 (GRCm38) T1416I unknown Het
Nrip1 A C 16: 76,293,269 (GRCm38) S467A probably damaging Het
Ntrk1 T A 3: 87,788,634 (GRCm38) N190Y probably damaging Het
Olfr193 A C 16: 59,110,601 (GRCm38) M3R probably benign Het
Olfr294 A T 7: 86,616,555 (GRCm38) L30Q probably null Het
Pdxp A G 15: 78,918,411 (GRCm38) S282G probably damaging Het
Phtf2 A T 5: 20,801,906 (GRCm38) S220T probably damaging Het
Piezo2 A T 18: 63,024,469 (GRCm38) V2390E probably damaging Het
Pop1 T G 15: 34,529,083 (GRCm38) L783R probably benign Het
Prf1 G A 10: 61,300,193 (GRCm38) A83T probably benign Het
Rab4b A G 7: 27,175,842 (GRCm38) V50A probably benign Het
Rtn1 T A 12: 72,304,326 (GRCm38) T370S probably benign Het
Sdr16c5 T A 4: 4,012,423 (GRCm38) I123F probably damaging Het
Smg6 T A 11: 75,156,165 (GRCm38) V1228D probably damaging Het
Smim19 A G 8: 22,473,523 (GRCm38) V23A probably benign Het
Sox13 A T 1: 133,386,258 (GRCm38) I346N probably damaging Het
Tap1 T A 17: 34,193,191 (GRCm38) Y457N probably damaging Het
Tbck C T 3: 132,752,666 (GRCm38) P686S probably damaging Het
Tcof1 A G 18: 60,831,938 (GRCm38) S570P unknown Het
Tmc5 A T 7: 118,672,226 (GRCm38) M921L probably benign Het
Ttc6 A G 12: 57,725,676 (GRCm38) Y1594C possibly damaging Het
Virma T A 4: 11,546,008 (GRCm38) H1615Q probably damaging Het
Vmn1r19 T A 6: 57,405,052 (GRCm38) Y197N probably damaging Het
Vps13c T C 9: 67,937,786 (GRCm38) F2051L probably damaging Het
Wdr6 C T 9: 108,574,566 (GRCm38) C706Y probably damaging Het
Zfand4 A G 6: 116,284,775 (GRCm38) N100D probably damaging Het
Other mutations in Abca16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Abca16 APN 7 120,423,759 (GRCm38) missense probably benign 0.08
IGL00590:Abca16 APN 7 120,423,815 (GRCm38) missense probably damaging 1.00
IGL01320:Abca16 APN 7 120,439,199 (GRCm38) missense probably damaging 1.00
IGL01322:Abca16 APN 7 120,439,199 (GRCm38) missense probably damaging 1.00
IGL01613:Abca16 APN 7 120,541,277 (GRCm38) missense probably benign 0.03
IGL01774:Abca16 APN 7 120,421,801 (GRCm38) splice site probably benign
IGL01774:Abca16 APN 7 120,477,835 (GRCm38) missense probably damaging 1.00
IGL01797:Abca16 APN 7 120,514,537 (GRCm38) missense probably benign 0.15
IGL02406:Abca16 APN 7 120,540,602 (GRCm38) missense probably damaging 1.00
IGL02437:Abca16 APN 7 120,533,729 (GRCm38) missense probably benign 0.00
IGL02541:Abca16 APN 7 120,514,658 (GRCm38) missense possibly damaging 0.91
IGL02576:Abca16 APN 7 120,433,455 (GRCm38) missense probably benign 0.05
IGL02578:Abca16 APN 7 120,423,956 (GRCm38) critical splice donor site probably null
IGL03156:Abca16 APN 7 120,423,851 (GRCm38) missense possibly damaging 0.69
IGL03381:Abca16 APN 7 120,527,818 (GRCm38) missense probably benign 0.12
R0024:Abca16 UTSW 7 120,433,385 (GRCm38) missense probably damaging 1.00
R0026:Abca16 UTSW 7 120,477,923 (GRCm38) splice site probably benign
R0026:Abca16 UTSW 7 120,477,923 (GRCm38) splice site probably benign
R0123:Abca16 UTSW 7 120,540,155 (GRCm38) missense probably damaging 1.00
R0134:Abca16 UTSW 7 120,540,155 (GRCm38) missense probably damaging 1.00
R0225:Abca16 UTSW 7 120,540,155 (GRCm38) missense probably damaging 1.00
R0346:Abca16 UTSW 7 120,435,932 (GRCm38) missense probably damaging 1.00
R0355:Abca16 UTSW 7 120,423,798 (GRCm38) missense possibly damaging 0.68
R0358:Abca16 UTSW 7 120,544,716 (GRCm38) missense probably benign 0.01
R0525:Abca16 UTSW 7 120,465,810 (GRCm38) nonsense probably null
R0617:Abca16 UTSW 7 120,433,611 (GRCm38) splice site probably benign
R0625:Abca16 UTSW 7 120,435,893 (GRCm38) missense probably damaging 1.00
R0835:Abca16 UTSW 7 120,465,784 (GRCm38) missense probably benign 0.42
R1445:Abca16 UTSW 7 120,520,033 (GRCm38) missense probably benign 0.41
R1535:Abca16 UTSW 7 120,540,705 (GRCm38) missense probably benign 0.30
R1567:Abca16 UTSW 7 120,431,129 (GRCm38) missense probably benign 0.08
R1694:Abca16 UTSW 7 120,520,084 (GRCm38) missense probably damaging 1.00
R1860:Abca16 UTSW 7 120,534,763 (GRCm38) missense probably benign 0.02
R1876:Abca16 UTSW 7 120,433,385 (GRCm38) missense probably damaging 1.00
R1913:Abca16 UTSW 7 120,541,240 (GRCm38) missense probably benign 0.04
R1940:Abca16 UTSW 7 120,433,609 (GRCm38) splice site probably benign
R2042:Abca16 UTSW 7 120,544,718 (GRCm38) missense probably benign
R2115:Abca16 UTSW 7 120,540,645 (GRCm38) missense probably damaging 1.00
R2122:Abca16 UTSW 7 120,519,961 (GRCm38) missense probably damaging 1.00
R2265:Abca16 UTSW 7 120,431,160 (GRCm38) missense probably benign 0.03
R2267:Abca16 UTSW 7 120,431,160 (GRCm38) missense probably benign 0.03
R2269:Abca16 UTSW 7 120,431,160 (GRCm38) missense probably benign 0.03
R2993:Abca16 UTSW 7 120,535,161 (GRCm38) missense probably damaging 1.00
R3055:Abca16 UTSW 7 120,435,851 (GRCm38) missense probably benign 0.05
R3956:Abca16 UTSW 7 120,527,752 (GRCm38) missense probably damaging 0.96
R4114:Abca16 UTSW 7 120,527,067 (GRCm38) missense probably benign 0.06
R4441:Abca16 UTSW 7 120,527,801 (GRCm38) missense probably benign 0.04
R4601:Abca16 UTSW 7 120,436,697 (GRCm38) missense probably damaging 0.98
R4706:Abca16 UTSW 7 120,465,765 (GRCm38) missense probably damaging 1.00
R4807:Abca16 UTSW 7 120,540,609 (GRCm38) missense probably damaging 1.00
R4824:Abca16 UTSW 7 120,475,479 (GRCm38) missense possibly damaging 0.86
R4937:Abca16 UTSW 7 120,527,086 (GRCm38) missense probably damaging 0.98
R5152:Abca16 UTSW 7 120,540,623 (GRCm38) missense probably benign 0.02
R5257:Abca16 UTSW 7 120,436,769 (GRCm38) critical splice donor site probably null
R5258:Abca16 UTSW 7 120,436,769 (GRCm38) critical splice donor site probably null
R5330:Abca16 UTSW 7 120,503,377 (GRCm38) missense probably benign 0.15
R5388:Abca16 UTSW 7 120,540,746 (GRCm38) critical splice donor site probably null
R5590:Abca16 UTSW 7 120,544,772 (GRCm38) missense probably damaging 0.98
R5810:Abca16 UTSW 7 120,435,932 (GRCm38) missense probably damaging 1.00
R6030:Abca16 UTSW 7 120,533,798 (GRCm38) missense probably benign
R6030:Abca16 UTSW 7 120,533,798 (GRCm38) missense probably benign
R6161:Abca16 UTSW 7 120,540,711 (GRCm38) missense probably damaging 1.00
R6313:Abca16 UTSW 7 120,527,121 (GRCm38) missense probably damaging 1.00
R6485:Abca16 UTSW 7 120,427,167 (GRCm38) nonsense probably null
R6527:Abca16 UTSW 7 120,477,772 (GRCm38) missense possibly damaging 0.95
R6772:Abca16 UTSW 7 120,527,053 (GRCm38) missense probably damaging 1.00
R6885:Abca16 UTSW 7 120,520,109 (GRCm38) missense probably benign 0.07
R6899:Abca16 UTSW 7 120,527,041 (GRCm38) missense probably damaging 1.00
R6941:Abca16 UTSW 7 120,541,147 (GRCm38) missense probably damaging 1.00
R6990:Abca16 UTSW 7 120,527,727 (GRCm38) missense probably benign 0.00
R7059:Abca16 UTSW 7 120,421,748 (GRCm38) missense probably benign 0.00
R7144:Abca16 UTSW 7 120,433,573 (GRCm38) missense possibly damaging 0.89
R7146:Abca16 UTSW 7 120,527,751 (GRCm38) missense possibly damaging 0.46
R7193:Abca16 UTSW 7 120,427,186 (GRCm38) missense probably damaging 1.00
R7308:Abca16 UTSW 7 120,423,770 (GRCm38) missense probably benign 0.01
R7449:Abca16 UTSW 7 120,435,908 (GRCm38) missense possibly damaging 0.95
R7571:Abca16 UTSW 7 120,519,988 (GRCm38) missense probably benign 0.11
R7617:Abca16 UTSW 7 120,503,471 (GRCm38) nonsense probably null
R7646:Abca16 UTSW 7 120,514,714 (GRCm38) missense probably benign 0.04
R7750:Abca16 UTSW 7 120,514,705 (GRCm38) missense probably benign 0.09
R7763:Abca16 UTSW 7 120,514,602 (GRCm38) missense probably damaging 1.00
R7840:Abca16 UTSW 7 120,475,466 (GRCm38) missense probably benign 0.00
R7946:Abca16 UTSW 7 120,527,175 (GRCm38) missense probably benign 0.01
R8018:Abca16 UTSW 7 120,533,643 (GRCm38) missense probably benign 0.04
R8170:Abca16 UTSW 7 120,465,782 (GRCm38) missense probably damaging 1.00
R8413:Abca16 UTSW 7 120,423,900 (GRCm38) missense probably benign 0.06
R8461:Abca16 UTSW 7 120,436,695 (GRCm38) missense possibly damaging 0.95
R8858:Abca16 UTSW 7 120,453,104 (GRCm38) missense probably benign
R8881:Abca16 UTSW 7 120,475,571 (GRCm38) missense probably benign 0.18
R9272:Abca16 UTSW 7 120,477,770 (GRCm38) missense probably benign 0.13
R9303:Abca16 UTSW 7 120,527,766 (GRCm38) missense probably benign 0.25
R9305:Abca16 UTSW 7 120,527,766 (GRCm38) missense probably benign 0.25
R9320:Abca16 UTSW 7 120,540,097 (GRCm38) missense probably damaging 0.98
R9413:Abca16 UTSW 7 120,527,199 (GRCm38) missense probably benign 0.01
R9512:Abca16 UTSW 7 120,423,740 (GRCm38) missense probably benign 0.01
R9559:Abca16 UTSW 7 120,421,796 (GRCm38) critical splice donor site probably null
R9615:Abca16 UTSW 7 120,527,181 (GRCm38) missense probably benign 0.01
R9641:Abca16 UTSW 7 120,527,085 (GRCm38) missense possibly damaging 0.52
R9643:Abca16 UTSW 7 120,465,800 (GRCm38) missense possibly damaging 0.96
R9674:Abca16 UTSW 7 120,475,445 (GRCm38) critical splice acceptor site probably null
R9714:Abca16 UTSW 7 120,431,160 (GRCm38) missense probably benign 0.01
R9799:Abca16 UTSW 7 120,533,775 (GRCm38) missense probably benign 0.00
R9800:Abca16 UTSW 7 120,520,060 (GRCm38) missense possibly damaging 0.68
RF020:Abca16 UTSW 7 120,533,657 (GRCm38) missense possibly damaging 0.90
X0066:Abca16 UTSW 7 120,503,386 (GRCm38) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CATGCTGTACCACATCCCTATGAG -3'
(R):5'- CTGATGTCTGAGCTTGGCAG -3'

Sequencing Primer
(F):5'- GATTTATATTCTGTGGAAGAGCTGAC -3'
(R):5'- ACTGCCTCCATGTGCCAGAG -3'
Posted On 2019-06-07