Incidental Mutation 'PIT4802001:Myh10'
ID556744
Institutional Source Beutler Lab
Gene Symbol Myh10
Ensembl Gene ENSMUSG00000020900
Gene Namemyosin, heavy polypeptide 10, non-muscle
SynonymsMyosin IIB, Fltn, Fltn, Myhn-2, myosin IIB, nonmuscle myosin heavy chain II-B, NMHC-B, Myhn2, SMemb, NMHC II-B, 5730504C04Rik, nonmuscle myosin heavy chain IIB, 9330167F11Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #PIT4802001 (G1)
Quality Score87.0076
Status Not validated
Chromosome11
Chromosomal Location68691559-68816632 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 68765092 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 471 (R471C)
Ref Sequence ENSEMBL: ENSMUSP00000090661 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018887] [ENSMUST00000092984] [ENSMUST00000102611]
Predicted Effect probably damaging
Transcript: ENSMUST00000018887
AA Change: R444C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000018887
Gene: ENSMUSG00000020900
AA Change: R444C

DomainStartEndE-ValueType
Pfam:Myosin_N 33 75 1.5e-15 PFAM
MYSc 79 815 N/A SMART
IQ 816 838 4.81e-4 SMART
low complexity region 932 946 N/A INTRINSIC
low complexity region 984 994 N/A INTRINSIC
low complexity region 1046 1058 N/A INTRINSIC
low complexity region 1070 1086 N/A INTRINSIC
Pfam:Myosin_tail_1 1104 1961 6.5e-211 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000092984
AA Change: R471C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000090661
Gene: ENSMUSG00000020900
AA Change: R471C

DomainStartEndE-ValueType
Pfam:Myosin_N 70 110 2.5e-13 PFAM
MYSc 116 821 N/A SMART
IQ 822 844 4.81e-4 SMART
Pfam:Myosin_tail_1 885 1965 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000102611
AA Change: R434C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099671
Gene: ENSMUSG00000020900
AA Change: R434C

DomainStartEndE-ValueType
Pfam:Myosin_N 33 75 1.4e-15 PFAM
MYSc 79 784 N/A SMART
IQ 785 807 4.81e-4 SMART
low complexity region 901 915 N/A INTRINSIC
low complexity region 953 963 N/A INTRINSIC
low complexity region 1015 1027 N/A INTRINSIC
low complexity region 1039 1055 N/A INTRINSIC
Pfam:Myosin_tail_1 1073 1930 6.2e-211 PFAM
Coding Region Coverage
  • 1x: 93.6%
  • 3x: 91.0%
  • 10x: 85.4%
  • 20x: 73.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the myosin superfamily. The protein represents a conventional non-muscle myosin; it should not be confused with the unconventional myosin-10 (MYO10). Myosins are actin-dependent motor proteins with diverse functions including regulation of cytokinesis, cell motility, and cell polarity. Mutations in this gene have been associated with May-Hegglin anomaly and developmental defects in brain and heart. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Nullizygous mice show pre- and neonatal death, heart defects and hydrocephaly. Deletion of exon B1 disrupts migration of facial neurons, whereas deletion of exon B2 leads to Purkinje cell anomalies. Hypomorphs show hydrocephaly and defects in motor control, cerebellar foliation and neuron migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk A T 11: 120,011,346 D741E probably benign Het
Abca16 A G 7: 120,540,128 D1461G probably benign Het
Adam6a G T 12: 113,545,458 D484Y probably damaging Het
Akap5 T C 12: 76,329,932 Y713H probably damaging Het
AW554918 A G 18: 25,340,075 E312G possibly damaging Het
Car4 G A 11: 84,964,405 A157T probably damaging Het
Chst9 A T 18: 15,452,792 M238K probably benign Het
Ctbp2 G A 7: 132,988,245 H397Y possibly damaging Het
Cyp3a59 A G 5: 146,102,801 M295V probably benign Het
Daglb T C 5: 143,503,048 Y586H probably benign Het
Ehbp1l1 G T 19: 5,719,575 P567T possibly damaging Het
Emilin2 A G 17: 71,273,469 I754T probably damaging Het
Esyt2 G A 12: 116,365,837 A672T probably benign Het
Evx1 G T 6: 52,314,190 E116* probably null Het
Exph5 T C 9: 53,374,978 S1120P probably damaging Het
Fam184a A T 10: 53,684,354 L515* probably null Het
Flt4 T A 11: 49,633,169 D525E probably benign Het
Galt T C 4: 41,756,764 W135R probably damaging Het
Ifitm6 A T 7: 141,016,735 C42S probably damaging Het
Ift172 A G 5: 31,285,266 S186P probably benign Het
Kcnk3 A G 5: 30,622,368 E254G probably damaging Het
Kmt2b A G 7: 30,579,571 S1509P probably damaging Het
Ky T A 9: 102,537,773 S295T probably benign Het
Lrba T A 3: 86,664,494 Y2368* probably null Het
Mtmr4 T A 11: 87,611,127 V669E probably benign Het
Nav1 G A 1: 135,452,933 T1416I unknown Het
Nrip1 A C 16: 76,293,269 S467A probably damaging Het
Ntrk1 T A 3: 87,788,634 N190Y probably damaging Het
Olfr193 A C 16: 59,110,601 M3R probably benign Het
Olfr294 A T 7: 86,616,555 L30Q probably null Het
Pdxp A G 15: 78,918,411 S282G probably damaging Het
Phtf2 A T 5: 20,801,906 S220T probably damaging Het
Piezo2 A T 18: 63,024,469 V2390E probably damaging Het
Pop1 T G 15: 34,529,083 L783R probably benign Het
Prf1 G A 10: 61,300,193 A83T probably benign Het
Rab4b A G 7: 27,175,842 V50A probably benign Het
Rtn1 T A 12: 72,304,326 T370S probably benign Het
Sdr16c5 T A 4: 4,012,423 I123F probably damaging Het
Smg6 T A 11: 75,156,165 V1228D probably damaging Het
Smim19 A G 8: 22,473,523 V23A probably benign Het
Sox13 A T 1: 133,386,258 I346N probably damaging Het
Tap1 T A 17: 34,193,191 Y457N probably damaging Het
Tbck C T 3: 132,752,666 P686S probably damaging Het
Tcof1 A G 18: 60,831,938 S570P unknown Het
Tmc5 A T 7: 118,672,226 M921L probably benign Het
Ttc6 A G 12: 57,725,676 Y1594C possibly damaging Het
Virma T A 4: 11,546,008 H1615Q probably damaging Het
Vmn1r19 T A 6: 57,405,052 Y197N probably damaging Het
Vps13c T C 9: 67,937,786 F2051L probably damaging Het
Wdr6 C T 9: 108,574,566 C706Y probably damaging Het
Zfand4 A G 6: 116,284,775 N100D probably damaging Het
Other mutations in Myh10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:Myh10 APN 11 68790708 missense probably benign 0.10
IGL01132:Myh10 APN 11 68768268 missense possibly damaging 0.93
IGL01348:Myh10 APN 11 68811803 missense probably benign 0.04
IGL01404:Myh10 APN 11 68752040 splice site probably null
IGL01409:Myh10 APN 11 68807219 missense probably damaging 0.98
IGL01660:Myh10 APN 11 68785889 missense probably benign 0.00
IGL02111:Myh10 APN 11 68790112 missense probably damaging 1.00
IGL02481:Myh10 APN 11 68802168 missense probably benign 0.00
IGL02483:Myh10 APN 11 68802168 missense probably benign 0.00
IGL02502:Myh10 APN 11 68814372 splice site probably null
IGL03178:Myh10 APN 11 68699413 missense probably benign 0.19
algia UTSW 11 68802931 missense probably damaging 1.00
itis UTSW 11 68764245 missense probably damaging 0.96
R0066:Myh10 UTSW 11 68699491 missense probably damaging 1.00
R0066:Myh10 UTSW 11 68699491 missense probably damaging 1.00
R0517:Myh10 UTSW 11 68811599 critical splice acceptor site probably null
R0855:Myh10 UTSW 11 68811801 missense possibly damaging 0.88
R1110:Myh10 UTSW 11 68791850 splice site probably benign
R1135:Myh10 UTSW 11 68807197 missense probably benign
R1169:Myh10 UTSW 11 68762841 missense probably damaging 0.99
R1643:Myh10 UTSW 11 68792010 missense probably damaging 0.96
R1733:Myh10 UTSW 11 68802296 missense probably benign 0.06
R1754:Myh10 UTSW 11 68813058 missense probably damaging 0.98
R1859:Myh10 UTSW 11 68745413 missense probably benign 0.03
R1898:Myh10 UTSW 11 68771906 missense probably damaging 1.00
R1905:Myh10 UTSW 11 68771868 splice site probably benign
R1914:Myh10 UTSW 11 68790208 missense probably damaging 0.99
R1915:Myh10 UTSW 11 68790208 missense probably damaging 0.99
R1987:Myh10 UTSW 11 68814496 missense possibly damaging 0.56
R2130:Myh10 UTSW 11 68807289 splice site probably benign
R2132:Myh10 UTSW 11 68807289 splice site probably benign
R2136:Myh10 UTSW 11 68804714 missense probably damaging 1.00
R2214:Myh10 UTSW 11 68783127 missense probably damaging 1.00
R2351:Myh10 UTSW 11 68793139 missense probably damaging 1.00
R3407:Myh10 UTSW 11 68790211 missense possibly damaging 0.68
R3721:Myh10 UTSW 11 68813052 missense probably damaging 0.99
R3908:Myh10 UTSW 11 68771059 critical splice donor site probably null
R4275:Myh10 UTSW 11 68751940 critical splice acceptor site probably null
R4526:Myh10 UTSW 11 68815049 missense probably benign 0.04
R4666:Myh10 UTSW 11 68801730 critical splice donor site probably null
R4668:Myh10 UTSW 11 68804642 missense probably damaging 1.00
R4750:Myh10 UTSW 11 68785314 missense probably damaging 1.00
R4968:Myh10 UTSW 11 68793223 missense probably damaging 1.00
R4977:Myh10 UTSW 11 68798371 missense possibly damaging 0.55
R5201:Myh10 UTSW 11 68783195 missense probably damaging 1.00
R5288:Myh10 UTSW 11 68801608 missense probably damaging 1.00
R5304:Myh10 UTSW 11 68764245 missense probably damaging 0.96
R5366:Myh10 UTSW 11 68760692 missense probably damaging 0.97
R5384:Myh10 UTSW 11 68801608 missense probably damaging 1.00
R5427:Myh10 UTSW 11 68802931 missense probably damaging 1.00
R5546:Myh10 UTSW 11 68798380 missense possibly damaging 0.90
R5551:Myh10 UTSW 11 68768287 missense possibly damaging 0.65
R5777:Myh10 UTSW 11 68785859 missense probably damaging 1.00
R5995:Myh10 UTSW 11 68814983 missense probably benign 0.01
R6021:Myh10 UTSW 11 68808862 missense possibly damaging 0.72
R6171:Myh10 UTSW 11 68791890 missense probably damaging 1.00
R6179:Myh10 UTSW 11 68802153 missense probably damaging 0.98
R6263:Myh10 UTSW 11 68810232 missense probably damaging 0.98
R6264:Myh10 UTSW 11 68745415 missense probably benign 0.01
R6484:Myh10 UTSW 11 68699467 missense probably damaging 1.00
R6575:Myh10 UTSW 11 68808850 missense probably benign 0.00
R6736:Myh10 UTSW 11 68745339 missense probably damaging 1.00
R7141:Myh10 UTSW 11 68802139 missense probably benign
R7256:Myh10 UTSW 11 68790689 missense probably damaging 1.00
R7329:Myh10 UTSW 11 68810191 missense probably benign 0.44
R7363:Myh10 UTSW 11 68815048 missense probably benign
R7576:Myh10 UTSW 11 68802166 missense probably damaging 1.00
R7577:Myh10 UTSW 11 68745980 missense unknown
R7681:Myh10 UTSW 11 68771936 missense probably damaging 0.98
R7813:Myh10 UTSW 11 68785909 missense probably benign 0.00
R7834:Myh10 UTSW 11 68785826 missense probably damaging 1.00
R7917:Myh10 UTSW 11 68785826 missense probably damaging 1.00
X0028:Myh10 UTSW 11 68793135 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACACTGAGCTGTAATTAAGCGG -3'
(R):5'- GTTTGACTCTAATCGAAGAGCAAG -3'

Sequencing Primer
(F):5'- AGCTGTAATTAAGCGGTGACTG -3'
(R):5'- GCAAGAAATGTACCTGCTCTGACTG -3'
Posted On2019-06-07