Incidental Mutation 'PIT4802001:Car4'
ID556746
Institutional Source Beutler Lab
Gene Symbol Car4
Ensembl Gene ENSMUSG00000000805
Gene Namecarbonic anhydrase 4
SynonymsCA IV
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.137) question?
Stock #PIT4802001 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location84957786-84966044 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 84964405 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 157 (A157T)
Ref Sequence ENSEMBL: ENSMUSP00000099483 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103194] [ENSMUST00000127827] [ENSMUST00000150596]
PDB Structure
MURINE CARBONIC ANHYDRASE IV [X-RAY DIFFRACTION]
MURINE CARBONIC ANHYDRASE IV COMPLEXED WITH BRINZOLAMIDE [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000103194
AA Change: A157T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000099483
Gene: ENSMUSG00000000805
AA Change: A157T

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Carb_anhydrase 22 278 2.37e-103 SMART
low complexity region 283 299 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000103711
Gene: ENSMUSG00000000805
AA Change: A20T

DomainStartEndE-ValueType
Carb_anhydrase 3 137 9.49e-7 SMART
low complexity region 142 158 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127827
Predicted Effect probably benign
Transcript: ENSMUST00000150596
Coding Region Coverage
  • 1x: 93.6%
  • 3x: 91.0%
  • 10x: 85.4%
  • 20x: 73.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Carbonic anhydrases (CAs) are a large family of zinc metalloenzymes that catalyze the reversible hydration of carbon dioxide. They participate in a variety of biological processes, including respiration, calcification, acid-base balance, bone resorption, and the formation of aqueous humor, cerebrospinal fluid, saliva, and gastric acid. They show extensive diversity in tissue distribution and in their subcellular localization. This gene encodes a glycosylphosphatidyl-inositol-anchored membrane isozyme expressed on the luminal surfaces of pulmonary (and certain other) capillaries and proximal renal tubules. Its exact function is not known; however, it may have a role in inherited renal abnormalities of bicarbonate transport. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are produced in lower than expected numbers, with females preferentially lost in the fetal or early postnatal period. Surviving homozygotes are healthy and fertile when crossed with wild-type partners; however, homozygous intercrosses yield small litters and pups do not survive. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk A T 11: 120,011,346 D741E probably benign Het
Abca16 A G 7: 120,540,128 D1461G probably benign Het
Adam6a G T 12: 113,545,458 D484Y probably damaging Het
Akap5 T C 12: 76,329,932 Y713H probably damaging Het
AW554918 A G 18: 25,340,075 E312G possibly damaging Het
Chst9 A T 18: 15,452,792 M238K probably benign Het
Ctbp2 G A 7: 132,988,245 H397Y possibly damaging Het
Cyp3a59 A G 5: 146,102,801 M295V probably benign Het
Daglb T C 5: 143,503,048 Y586H probably benign Het
Ehbp1l1 G T 19: 5,719,575 P567T possibly damaging Het
Emilin2 A G 17: 71,273,469 I754T probably damaging Het
Esyt2 G A 12: 116,365,837 A672T probably benign Het
Evx1 G T 6: 52,314,190 E116* probably null Het
Exph5 T C 9: 53,374,978 S1120P probably damaging Het
Fam184a A T 10: 53,684,354 L515* probably null Het
Flt4 T A 11: 49,633,169 D525E probably benign Het
Galt T C 4: 41,756,764 W135R probably damaging Het
Ifitm6 A T 7: 141,016,735 C42S probably damaging Het
Ift172 A G 5: 31,285,266 S186P probably benign Het
Kcnk3 A G 5: 30,622,368 E254G probably damaging Het
Kmt2b A G 7: 30,579,571 S1509P probably damaging Het
Ky T A 9: 102,537,773 S295T probably benign Het
Lrba T A 3: 86,664,494 Y2368* probably null Het
Mtmr4 T A 11: 87,611,127 V669E probably benign Het
Myh10 C T 11: 68,765,092 R471C probably damaging Het
Nav1 G A 1: 135,452,933 T1416I unknown Het
Nrip1 A C 16: 76,293,269 S467A probably damaging Het
Ntrk1 T A 3: 87,788,634 N190Y probably damaging Het
Olfr193 A C 16: 59,110,601 M3R probably benign Het
Olfr294 A T 7: 86,616,555 L30Q probably null Het
Pdxp A G 15: 78,918,411 S282G probably damaging Het
Phtf2 A T 5: 20,801,906 S220T probably damaging Het
Piezo2 A T 18: 63,024,469 V2390E probably damaging Het
Pop1 T G 15: 34,529,083 L783R probably benign Het
Prf1 G A 10: 61,300,193 A83T probably benign Het
Rab4b A G 7: 27,175,842 V50A probably benign Het
Rtn1 T A 12: 72,304,326 T370S probably benign Het
Sdr16c5 T A 4: 4,012,423 I123F probably damaging Het
Smg6 T A 11: 75,156,165 V1228D probably damaging Het
Smim19 A G 8: 22,473,523 V23A probably benign Het
Sox13 A T 1: 133,386,258 I346N probably damaging Het
Tap1 T A 17: 34,193,191 Y457N probably damaging Het
Tbck C T 3: 132,752,666 P686S probably damaging Het
Tcof1 A G 18: 60,831,938 S570P unknown Het
Tmc5 A T 7: 118,672,226 M921L probably benign Het
Ttc6 A G 12: 57,725,676 Y1594C possibly damaging Het
Virma T A 4: 11,546,008 H1615Q probably damaging Het
Vmn1r19 T A 6: 57,405,052 Y197N probably damaging Het
Vps13c T C 9: 67,937,786 F2051L probably damaging Het
Wdr6 C T 9: 108,574,566 C706Y probably damaging Het
Zfand4 A G 6: 116,284,775 N100D probably damaging Het
Other mutations in Car4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Car4 APN 11 84965767 missense probably damaging 1.00
IGL01121:Car4 APN 11 84964346 critical splice acceptor site probably null
IGL01828:Car4 APN 11 84964745 missense probably benign 0.19
IGL02340:Car4 APN 11 84965767 missense probably damaging 1.00
IGL02351:Car4 APN 11 84965767 missense probably damaging 1.00
IGL02353:Car4 APN 11 84965767 missense probably damaging 1.00
IGL02358:Car4 APN 11 84965767 missense probably damaging 1.00
IGL02360:Car4 APN 11 84965767 missense probably damaging 1.00
R0008:Car4 UTSW 11 84963411 unclassified probably benign
R0501:Car4 UTSW 11 84963442 missense probably benign 0.01
R2124:Car4 UTSW 11 84964085 splice site probably benign
R3907:Car4 UTSW 11 84964357 missense probably damaging 1.00
R5072:Car4 UTSW 11 84963367 missense probably benign
R5268:Car4 UTSW 11 84965800 missense probably benign 0.28
R5562:Car4 UTSW 11 84964098 missense probably benign 0.05
R6508:Car4 UTSW 11 84965643 missense possibly damaging 0.64
R7775:Car4 UTSW 11 84965623 missense probably damaging 1.00
Z1177:Car4 UTSW 11 84963419 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TGATGGGAGACACTTTGCC -3'
(R):5'- AACCTGACTCACGGGGTTTG -3'

Sequencing Primer
(F):5'- CTTTGCCATGGAGGTAAGAAGCC -3'
(R):5'- CTCCTTCTGGAGGATGGG -3'
Posted On2019-06-07