Mutagenetix > Incidental Mutation

Incidental Mutation 'PIT4802001:Pop1'

556754

Institutional Source

Beutler Lab

Gene Symbol

Pop1

Ensembl Gene

ENSMUSG00000022325

Gene Name

processing of precursor 1, ribonuclease P/MRP family, (S. cerevisiae)

Synonyms

4932434G09Rik

Accession Numbers

Essential gene?

Probably essential (E-score: 0.961) question?

Stock #

PIT4802001 (G1)

Quality Score

166.009

Status

Not validated

Chromosome

Chromosomal Location

34495304-34530648 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 34529083 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Arginine at position 783 (L783R)

Ref Sequence

ENSEMBL: ENSMUSP00000052654 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000052290] [ENSMUST00000079028]

AlphaFold

Q8K205

Predicted Effect

probably benign
Transcript: ENSMUST00000052290
AA Change: L783R

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000052654
Gene: ENSMUSG00000022325
AA Change: L783R

Domain	Start	End	E-Value	Type
Pfam:POP1	107	190	6.2e-21	PFAM
Pfam:POP1	179	257	2.5e-23	PFAM
low complexity region	382	387	N/A	INTRINSIC
Pfam:POPLD	647	738	1.4e-30	PFAM
low complexity region	931	940	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000079028
AA Change: L753R

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000078037
Gene: ENSMUSG00000022325
AA Change: L753R

Domain	Start	End	E-Value	Type
Pfam:POP1	107	258	1e-46	PFAM
low complexity region	382	387	N/A	INTRINSIC
Pfam:POPLD	617	708	1.2e-34	PFAM
low complexity region	901	910	N/A	INTRINSIC

Coding Region Coverage

1x: 93.6%
3x: 91.0%
10x: 85.4%
20x: 73.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the protein subunit of two different small nucleolar ribonucleoprotein complexes: the endoribonuclease for mitochondrial RNA processing complex and the ribonuclease P complex. The encoded protein is a ribonuclease that localizes to the nucleus and functions in pre-RNA processing. This protein is also an autoantigen in patients suffering from connective tissue diseases. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2009]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aatk	A	T	11: 120,011,346	D741E	probably benign	Het
Abca16	A	G	7: 120,540,128	D1461G	probably benign	Het
Adam6a	G	T	12: 113,545,458	D484Y	probably damaging	Het
Akap5	T	C	12: 76,329,932	Y713H	probably damaging	Het
AW554918	A	G	18: 25,340,075	E312G	possibly damaging	Het
Car4	G	A	11: 84,964,405	A157T	probably damaging	Het
Chst9	A	T	18: 15,452,792	M238K	probably benign	Het
Ctbp2	G	A	7: 132,988,245	H397Y	possibly damaging	Het
Cyp3a59	A	G	5: 146,102,801	M295V	probably benign	Het
Daglb	T	C	5: 143,503,048	Y586H	probably benign	Het
Ehbp1l1	G	T	19: 5,719,575	P567T	possibly damaging	Het
Emilin2	A	G	17: 71,273,469	I754T	probably damaging	Het
Esyt2	G	A	12: 116,365,837	A672T	probably benign	Het
Evx1	G	T	6: 52,314,190	E116*	probably null	Het
Exph5	T	C	9: 53,374,978	S1120P	probably damaging	Het
Fam184a	A	T	10: 53,684,354	L515*	probably null	Het
Flt4	T	A	11: 49,633,169	D525E	probably benign	Het
Galt	T	C	4: 41,756,764	W135R	probably damaging	Het
Ifitm6	A	T	7: 141,016,735	C42S	probably damaging	Het
Ift172	A	G	5: 31,285,266	S186P	probably benign	Het
Kcnk3	A	G	5: 30,622,368	E254G	probably damaging	Het
Kmt2b	A	G	7: 30,579,571	S1509P	probably damaging	Het
Ky	T	A	9: 102,537,773	S295T	probably benign	Het
Lrba	T	A	3: 86,664,494	Y2368*	probably null	Het
Mtmr4	T	A	11: 87,611,127	V669E	probably benign	Het
Myh10	C	T	11: 68,765,092	R471C	probably damaging	Het
Nav1	G	A	1: 135,452,933	T1416I	unknown	Het
Nrip1	A	C	16: 76,293,269	S467A	probably damaging	Het
Ntrk1	T	A	3: 87,788,634	N190Y	probably damaging	Het
Olfr193	A	C	16: 59,110,601	M3R	probably benign	Het
Olfr294	A	T	7: 86,616,555	L30Q	probably null	Het
Pdxp	A	G	15: 78,918,411	S282G	probably damaging	Het
Phtf2	A	T	5: 20,801,906	S220T	probably damaging	Het
Piezo2	A	T	18: 63,024,469	V2390E	probably damaging	Het
Prf1	G	A	10: 61,300,193	A83T	probably benign	Het
Rab4b	A	G	7: 27,175,842	V50A	probably benign	Het
Rtn1	T	A	12: 72,304,326	T370S	probably benign	Het
Sdr16c5	T	A	4: 4,012,423	I123F	probably damaging	Het
Smg6	T	A	11: 75,156,165	V1228D	probably damaging	Het
Smim19	A	G	8: 22,473,523	V23A	probably benign	Het
Sox13	A	T	1: 133,386,258	I346N	probably damaging	Het
Tap1	T	A	17: 34,193,191	Y457N	probably damaging	Het
Tbck	C	T	3: 132,752,666	P686S	probably damaging	Het
Tcof1	A	G	18: 60,831,938	S570P	unknown	Het
Tmc5	A	T	7: 118,672,226	M921L	probably benign	Het
Ttc6	A	G	12: 57,725,676	Y1594C	possibly damaging	Het
Virma	T	A	4: 11,546,008	H1615Q	probably damaging	Het
Vmn1r19	T	A	6: 57,405,052	Y197N	probably damaging	Het
Vps13c	T	C	9: 67,937,786	F2051L	probably damaging	Het
Wdr6	C	T	9: 108,574,566	C706Y	probably damaging	Het
Zfand4	A	G	6: 116,284,775	N100D	probably damaging	Het

Other mutations in Pop1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00848:Pop1	APN	15	34508729	missense	probably benign	0.00
IGL02192:Pop1	APN	15	34529071	missense	probably benign	0.08
IGL02680:Pop1	APN	15	34502473	missense	probably damaging	0.99
IGL02958:Pop1	APN	15	34530363	missense	probably damaging	0.99
H8562:Pop1	UTSW	15	34530212	missense	probably benign	0.00
R0244:Pop1	UTSW	15	34515891	nonsense	probably null
R0281:Pop1	UTSW	15	34529858	splice site	probably null
R0453:Pop1	UTSW	15	34526206	missense	possibly damaging	0.82
R0579:Pop1	UTSW	15	34509969	missense	possibly damaging	0.68
R1054:Pop1	UTSW	15	34509809	missense	probably benign	0.30
R1501:Pop1	UTSW	15	34510357	missense	probably benign	0.01
R1614:Pop1	UTSW	15	34530210	missense	possibly damaging	0.46
R1994:Pop1	UTSW	15	34530471	missense	probably damaging	1.00
R2084:Pop1	UTSW	15	34508598	splice site	probably benign
R4020:Pop1	UTSW	15	34508780	missense	probably benign	0.01
R4550:Pop1	UTSW	15	34528936	missense	probably damaging	1.00
R4579:Pop1	UTSW	15	34515824	intron	probably benign
R5672:Pop1	UTSW	15	34530179	missense	possibly damaging	0.63
R6139:Pop1	UTSW	15	34529058	missense	probably benign	0.26
R6161:Pop1	UTSW	15	34526310	missense	probably damaging	1.00
R6821:Pop1	UTSW	15	34508639	missense	possibly damaging	0.86
R7053:Pop1	UTSW	15	34530275	missense	probably benign	0.01
R7195:Pop1	UTSW	15	34510379	missense	probably damaging	0.97
R7543:Pop1	UTSW	15	34530447	missense	probably damaging	1.00
R7571:Pop1	UTSW	15	34528947	missense	probably null	1.00
R7587:Pop1	UTSW	15	34502413	missense	probably damaging	0.97
R8401:Pop1	UTSW	15	34508609	missense	probably damaging	1.00
R8406:Pop1	UTSW	15	34529170	missense	probably benign
R8707:Pop1	UTSW	15	34529203	missense	probably benign	0.02
R9044:Pop1	UTSW	15	34530408	missense	possibly damaging	0.94
R9066:Pop1	UTSW	15	34515914	missense	possibly damaging	0.68
R9236:Pop1	UTSW	15	34499412	missense	probably damaging	0.98
R9600:Pop1	UTSW	15	34512735	missense	probably benign	0.06
R9711:Pop1	UTSW	15	34530081	missense	probably benign
RF001:Pop1	UTSW	15	34502437	missense	probably damaging	1.00
RF002:Pop1	UTSW	15	34502437	missense	probably damaging	1.00
Z1088:Pop1	UTSW	15	34499319	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAGGCCCAACTATGTTAAGCTTG -3'
(R):5'- GTTCATACCCAGAGCCTGTTC -3'

Sequencing Primer
(F):5'- TTAAGCTTGGCACACTGGC -3'
(R):5'- TACCCAGAGCCTGTTCAATATGG -3'

Posted On

2019-06-07