Incidental Mutation 'PIT4696001:Dr1'
ID556782
Institutional Source Beutler Lab
Gene Symbol Dr1
Ensembl Gene ENSMUSG00000029265
Gene Namedown-regulator of transcription 1
SynonymsDr1l, NC2, 1700121L09Rik, NC2beta
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.951) question?
Stock #PIT4696001 (G1)
Quality Score219.009
Status Validated
Chromosome5
Chromosomal Location108268897-108280526 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 108269738 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 50 (I50K)
Ref Sequence ENSEMBL: ENSMUSP00000031190 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031190]
Predicted Effect probably damaging
Transcript: ENSMUST00000031190
AA Change: I50K

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000031190
Gene: ENSMUSG00000029265
AA Change: I50K

DomainStartEndE-ValueType
Pfam:CBFD_NFYB_HMF 11 75 1.7e-24 PFAM
low complexity region 115 125 N/A INTRINSIC
low complexity region 127 168 N/A INTRINSIC
Coding Region Coverage
  • 1x: 93.5%
  • 3x: 91.0%
  • 10x: 86.2%
  • 20x: 75.9%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a TBP- (TATA box-binding protein) associated phosphoprotein that represses both basal and activated levels of transcription. The encoded protein is phosphorylated in vivo and this phosphorylation affects its interaction with TBP. This protein contains a histone fold motif at the amino terminus, a TBP-binding domain, and a glutamine- and alanine-rich region. The binding of DR1 repressor complexes to TBP-promoter complexes may establish a mechanism in which an altered DNA conformation, together with the formation of higher order complexes, inhibits the assembly of the preinitiation complex and controls the rate of RNA polymerase II transcription. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm3 G A 7: 119,784,986 probably null Het
Adam20 T A 8: 40,794,948 Y32N probably benign Het
Adm T C 7: 110,628,289 V4A probably benign Het
Anpep G A 7: 79,839,464 T320I possibly damaging Het
Atp8b1 T C 18: 64,539,270 S1008G possibly damaging Het
B9d1 T A 11: 61,505,243 M12K possibly damaging Het
Cad T C 5: 31,072,094 L1435P probably damaging Het
Cat T C 2: 103,471,812 D180G probably damaging Het
Cntln C T 4: 84,974,000 T374M probably damaging Het
Cyp2a5 G A 7: 26,840,979 R339Q probably benign Het
Defa22 T C 8: 21,162,336 L6P probably damaging Het
Eln C T 5: 134,737,178 G57E unknown Het
Fat4 T C 3: 38,889,004 I682T probably benign Het
Fat4 C A 3: 38,982,357 A3386E probably damaging Het
Fcgr3 T A 1: 171,057,750 Y102F probably damaging Het
Gm5930 A T 14: 44,336,536 L115M probably damaging Het
Herc1 T A 9: 66,479,009 V3748D probably damaging Het
Ino80d A G 1: 63,085,986 S106P probably benign Het
Kcns3 C T 12: 11,092,748 probably benign Het
Kndc1 T A 7: 139,932,917 L1527Q probably damaging Het
Lepr T G 4: 101,779,983 S690A probably benign Het
Lrfn5 T C 12: 61,843,557 F544S probably damaging Het
Mapkap1 C A 2: 34,619,849 H450Q probably damaging Het
Mdm1 A G 10: 118,158,540 T485A probably benign Het
Megf10 T C 18: 57,277,688 C690R probably damaging Het
Myo7a A G 7: 98,063,599 M1723T probably benign Het
Nrip3 A T 7: 109,765,507 C137* probably null Het
Olfr153 T A 2: 87,532,780 I249N probably damaging Het
Pde4a T A 9: 21,211,001 M731K probably benign Het
Pebp1 A G 5: 117,283,462 L117P probably damaging Het
Phc2 T C 4: 128,705,202 Y51H probably damaging Het
Ppp2r5b A G 19: 6,234,683 F50S probably benign Het
Prpf4b A G 13: 34,899,842 S865G probably benign Het
Ptpn5 C T 7: 47,088,606 V243M probably benign Het
Rora T C 9: 69,364,559 L273P possibly damaging Het
Rtp4 T A 16: 23,613,454 S245R probably benign Het
Scgb2b20 C T 7: 33,364,560 G95D probably benign Het
Sec24b A G 3: 129,994,391 V820A probably benign Het
Sim2 A G 16: 94,094,309 D62G possibly damaging Het
Slc17a4 A T 13: 23,900,514 V429D probably benign Het
Sp2 T C 11: 96,961,973 T42A probably damaging Het
Spata3 G A 1: 86,024,447 R141Q unknown Het
Sptbn2 A T 19: 4,745,577 E1658D probably benign Het
Tcaf1 T C 6: 42,678,539 H501R probably benign Het
Tec G A 5: 72,773,835 T262M possibly damaging Het
Timm9 A T 12: 71,125,531 N22K possibly damaging Het
Tln1 C T 4: 43,542,701 probably null Het
Tmbim4 A G 10: 120,217,624 I109M probably benign Het
Tmc7 T C 7: 118,564,343 K110E probably benign Het
Tmem107 C T 11: 69,072,573 P136L probably benign Het
Ttc21b T C 2: 66,231,219 probably null Het
Ubd A C 17: 37,195,444 T74P probably damaging Het
Vps11 A G 9: 44,358,189 V255A possibly damaging Het
Vsnl1 T C 12: 11,326,447 T146A probably benign Het
Wdr38 G T 2: 38,999,972 probably null Het
Yes1 T A 5: 32,684,625 S498T possibly damaging Het
Zc3h13 G A 14: 75,331,883 R1390H probably damaging Het
Zscan4b A G 7: 10,902,022 V126A possibly damaging Het
Other mutations in Dr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01403:Dr1 APN 5 108269710 missense possibly damaging 0.68
IGL03231:Dr1 APN 5 108275608 missense probably benign 0.07
R0550:Dr1 UTSW 5 108269605 missense probably benign 0.09
R1682:Dr1 UTSW 5 108269738 missense probably damaging 1.00
R7366:Dr1 UTSW 5 108275728 missense unknown
X0027:Dr1 UTSW 5 108269779 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGCCTGTTGAGAAATCTTCG -3'
(R):5'- AGTGGAATGAAGGCTCTGTG -3'

Sequencing Primer
(F):5'- CCTGTTGAGAAATCTTCGTGGAG -3'
(R):5'- GACGCCAAGTGGTTACTCTATTAGC -3'
Posted On2019-06-07