Incidental Mutation 'PIT4696001:Tcaf1'
ID556785
Institutional Source Beutler Lab
Gene Symbol Tcaf1
Ensembl Gene ENSMUSG00000036667
Gene NameTRPM8 channel-associated factor 1
SynonymsA230020K05Rik, 2810407D09Rik, Fam115a, 3321401G04Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #PIT4696001 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location42668002-42710088 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 42678539 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 501 (H501R)
Ref Sequence ENSEMBL: ENSMUSP00000046137 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045054] [ENSMUST00000045140] [ENSMUST00000121083]
Predicted Effect probably benign
Transcript: ENSMUST00000045054
AA Change: H501R

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000046137
Gene: ENSMUSG00000036667
AA Change: H501R

DomainStartEndE-ValueType
internal_repeat_1 14 197 6.95e-30 PROSPERO
low complexity region 207 221 N/A INTRINSIC
internal_repeat_1 222 406 6.95e-30 PROSPERO
low complexity region 463 474 N/A INTRINSIC
M60-like 542 841 1.94e-128 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000045140
AA Change: H501R

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000036379
Gene: ENSMUSG00000036667
AA Change: H501R

DomainStartEndE-ValueType
internal_repeat_1 14 197 6.95e-30 PROSPERO
low complexity region 207 221 N/A INTRINSIC
internal_repeat_1 222 406 6.95e-30 PROSPERO
low complexity region 463 474 N/A INTRINSIC
M60-like 542 841 1.94e-128 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121083
AA Change: H501R

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000114036
Gene: ENSMUSG00000036667
AA Change: H501R

DomainStartEndE-ValueType
internal_repeat_1 14 197 6.95e-30 PROSPERO
low complexity region 207 221 N/A INTRINSIC
internal_repeat_1 222 406 6.95e-30 PROSPERO
low complexity region 463 474 N/A INTRINSIC
M60-like 542 841 1.94e-128 SMART
Coding Region Coverage
  • 1x: 93.5%
  • 3x: 91.0%
  • 10x: 86.2%
  • 20x: 75.9%
Validation Efficiency 100% (57/57)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm3 G A 7: 119,784,986 probably null Het
Adam20 T A 8: 40,794,948 Y32N probably benign Het
Adm T C 7: 110,628,289 V4A probably benign Het
Anpep G A 7: 79,839,464 T320I possibly damaging Het
Atp8b1 T C 18: 64,539,270 S1008G possibly damaging Het
B9d1 T A 11: 61,505,243 M12K possibly damaging Het
Cad T C 5: 31,072,094 L1435P probably damaging Het
Cat T C 2: 103,471,812 D180G probably damaging Het
Cntln C T 4: 84,974,000 T374M probably damaging Het
Cyp2a5 G A 7: 26,840,979 R339Q probably benign Het
Defa22 T C 8: 21,162,336 L6P probably damaging Het
Dr1 T A 5: 108,269,738 I50K probably damaging Het
Eln C T 5: 134,737,178 G57E unknown Het
Fat4 T C 3: 38,889,004 I682T probably benign Het
Fat4 C A 3: 38,982,357 A3386E probably damaging Het
Fcgr3 T A 1: 171,057,750 Y102F probably damaging Het
Gm5930 A T 14: 44,336,536 L115M probably damaging Het
Herc1 T A 9: 66,479,009 V3748D probably damaging Het
Ino80d A G 1: 63,085,986 S106P probably benign Het
Kcns3 C T 12: 11,092,748 probably benign Het
Kndc1 T A 7: 139,932,917 L1527Q probably damaging Het
Lepr T G 4: 101,779,983 S690A probably benign Het
Lrfn5 T C 12: 61,843,557 F544S probably damaging Het
Mapkap1 C A 2: 34,619,849 H450Q probably damaging Het
Mdm1 A G 10: 118,158,540 T485A probably benign Het
Megf10 T C 18: 57,277,688 C690R probably damaging Het
Myo7a A G 7: 98,063,599 M1723T probably benign Het
Nrip3 A T 7: 109,765,507 C137* probably null Het
Olfr153 T A 2: 87,532,780 I249N probably damaging Het
Pde4a T A 9: 21,211,001 M731K probably benign Het
Pebp1 A G 5: 117,283,462 L117P probably damaging Het
Phc2 T C 4: 128,705,202 Y51H probably damaging Het
Ppp2r5b A G 19: 6,234,683 F50S probably benign Het
Prpf4b A G 13: 34,899,842 S865G probably benign Het
Ptpn5 C T 7: 47,088,606 V243M probably benign Het
Rora T C 9: 69,364,559 L273P possibly damaging Het
Rtp4 T A 16: 23,613,454 S245R probably benign Het
Scgb2b20 C T 7: 33,364,560 G95D probably benign Het
Sec24b A G 3: 129,994,391 V820A probably benign Het
Sim2 A G 16: 94,094,309 D62G possibly damaging Het
Slc17a4 A T 13: 23,900,514 V429D probably benign Het
Sp2 T C 11: 96,961,973 T42A probably damaging Het
Spata3 G A 1: 86,024,447 R141Q unknown Het
Sptbn2 A T 19: 4,745,577 E1658D probably benign Het
Tec G A 5: 72,773,835 T262M possibly damaging Het
Timm9 A T 12: 71,125,531 N22K possibly damaging Het
Tln1 C T 4: 43,542,701 probably null Het
Tmbim4 A G 10: 120,217,624 I109M probably benign Het
Tmc7 T C 7: 118,564,343 K110E probably benign Het
Tmem107 C T 11: 69,072,573 P136L probably benign Het
Ttc21b T C 2: 66,231,219 probably null Het
Ubd A C 17: 37,195,444 T74P probably damaging Het
Vps11 A G 9: 44,358,189 V255A possibly damaging Het
Vsnl1 T C 12: 11,326,447 T146A probably benign Het
Wdr38 G T 2: 38,999,972 probably null Het
Yes1 T A 5: 32,684,625 S498T possibly damaging Het
Zc3h13 G A 14: 75,331,883 R1390H probably damaging Het
Zscan4b A G 7: 10,902,022 V126A possibly damaging Het
Other mutations in Tcaf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01090:Tcaf1 APN 6 42686622 missense probably benign
IGL02415:Tcaf1 APN 6 42686650 missense probably benign 0.00
IGL02504:Tcaf1 APN 6 42679279 missense probably benign 0.05
IGL02960:Tcaf1 APN 6 42686459 missense probably benign
IGL03022:Tcaf1 APN 6 42678126 nonsense probably null
R0103:Tcaf1 UTSW 6 42686390 missense probably benign 0.23
R0103:Tcaf1 UTSW 6 42686390 missense probably benign 0.23
R0586:Tcaf1 UTSW 6 42673539 missense probably damaging 1.00
R0717:Tcaf1 UTSW 6 42678665 missense probably benign 0.01
R0724:Tcaf1 UTSW 6 42675367 missense probably damaging 1.00
R1166:Tcaf1 UTSW 6 42678678 missense probably benign
R1472:Tcaf1 UTSW 6 42686448 missense possibly damaging 0.83
R1538:Tcaf1 UTSW 6 42678989 missense probably damaging 1.00
R1721:Tcaf1 UTSW 6 42675338 missense possibly damaging 0.90
R1776:Tcaf1 UTSW 6 42678455 missense possibly damaging 0.90
R2136:Tcaf1 UTSW 6 42673520 missense probably benign 0.01
R3433:Tcaf1 UTSW 6 42686574 missense probably damaging 0.98
R3951:Tcaf1 UTSW 6 42679059 missense probably benign 0.14
R4472:Tcaf1 UTSW 6 42679314 missense probably benign
R4740:Tcaf1 UTSW 6 42686875 missense probably benign
R4915:Tcaf1 UTSW 6 42675196 missense probably damaging 1.00
R5249:Tcaf1 UTSW 6 42676859 missense probably benign 0.00
R5340:Tcaf1 UTSW 6 42678989 missense probably damaging 1.00
R5458:Tcaf1 UTSW 6 42686542 missense probably benign
R6196:Tcaf1 UTSW 6 42676807 missense probably damaging 1.00
R6772:Tcaf1 UTSW 6 42675276 missense probably damaging 1.00
R7066:Tcaf1 UTSW 6 42679177 missense probably damaging 1.00
R7145:Tcaf1 UTSW 6 42686753 missense probably damaging 1.00
R7204:Tcaf1 UTSW 6 42675039 splice site probably null
R7529:Tcaf1 UTSW 6 42675355 missense probably damaging 1.00
R7554:Tcaf1 UTSW 6 42677454 missense probably benign 0.13
R7813:Tcaf1 UTSW 6 42673429 nonsense probably null
RF013:Tcaf1 UTSW 6 42679173 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- ACACTGCAGCAGTCTTGTG -3'
(R):5'- TCCAGGTGATAATGGGCAGG -3'

Sequencing Primer
(F):5'- AGCAGTCTTGTGCCCCTG -3'
(R):5'- CCAAGCTAGGCCCAGATG -3'
Posted On2019-06-07