Incidental Mutation 'PIT4696001:Zscan4b'
ID556786
Institutional Source Beutler Lab
Gene Symbol Zscan4b
Ensembl Gene ENSMUSG00000095339
Gene Namezinc finger and SCAN domain containing 4B
SynonymsEG665780
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #PIT4696001 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location10900740-10905050 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 10902022 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 126 (V126A)
Ref Sequence ENSEMBL: ENSMUSP00000127301 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168158] [ENSMUST00000210847]
Predicted Effect possibly damaging
Transcript: ENSMUST00000168158
AA Change: V126A

PolyPhen 2 Score 0.771 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000127301
Gene: ENSMUSG00000095339
AA Change: V126A

DomainStartEndE-ValueType
Pfam:SCAN 43 122 1.8e-17 PFAM
low complexity region 181 192 N/A INTRINSIC
ZnF_C2H2 394 416 2.75e-3 SMART
ZnF_C2H2 423 445 6.57e-1 SMART
ZnF_C2H2 451 473 7.26e-3 SMART
ZnF_C2H2 479 502 3.83e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000210847
AA Change: V126A

PolyPhen 2 Score 0.771 (Sensitivity: 0.85; Specificity: 0.92)
Coding Region Coverage
  • 1x: 93.5%
  • 3x: 91.0%
  • 10x: 86.2%
  • 20x: 75.9%
Validation Efficiency 100% (57/57)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm3 G A 7: 119,784,986 probably null Het
Adam20 T A 8: 40,794,948 Y32N probably benign Het
Adm T C 7: 110,628,289 V4A probably benign Het
Anpep G A 7: 79,839,464 T320I possibly damaging Het
Atp8b1 T C 18: 64,539,270 S1008G possibly damaging Het
B9d1 T A 11: 61,505,243 M12K possibly damaging Het
Cad T C 5: 31,072,094 L1435P probably damaging Het
Cat T C 2: 103,471,812 D180G probably damaging Het
Cntln C T 4: 84,974,000 T374M probably damaging Het
Cyp2a5 G A 7: 26,840,979 R339Q probably benign Het
Defa22 T C 8: 21,162,336 L6P probably damaging Het
Dr1 T A 5: 108,269,738 I50K probably damaging Het
Eln C T 5: 134,737,178 G57E unknown Het
Fat4 T C 3: 38,889,004 I682T probably benign Het
Fat4 C A 3: 38,982,357 A3386E probably damaging Het
Fcgr3 T A 1: 171,057,750 Y102F probably damaging Het
Gm5930 A T 14: 44,336,536 L115M probably damaging Het
Herc1 T A 9: 66,479,009 V3748D probably damaging Het
Ino80d A G 1: 63,085,986 S106P probably benign Het
Kcns3 C T 12: 11,092,748 probably benign Het
Kndc1 T A 7: 139,932,917 L1527Q probably damaging Het
Lepr T G 4: 101,779,983 S690A probably benign Het
Lrfn5 T C 12: 61,843,557 F544S probably damaging Het
Mapkap1 C A 2: 34,619,849 H450Q probably damaging Het
Mdm1 A G 10: 118,158,540 T485A probably benign Het
Megf10 T C 18: 57,277,688 C690R probably damaging Het
Myo7a A G 7: 98,063,599 M1723T probably benign Het
Nrip3 A T 7: 109,765,507 C137* probably null Het
Olfr153 T A 2: 87,532,780 I249N probably damaging Het
Pde4a T A 9: 21,211,001 M731K probably benign Het
Pebp1 A G 5: 117,283,462 L117P probably damaging Het
Phc2 T C 4: 128,705,202 Y51H probably damaging Het
Ppp2r5b A G 19: 6,234,683 F50S probably benign Het
Prpf4b A G 13: 34,899,842 S865G probably benign Het
Ptpn5 C T 7: 47,088,606 V243M probably benign Het
Rora T C 9: 69,364,559 L273P possibly damaging Het
Rtp4 T A 16: 23,613,454 S245R probably benign Het
Scgb2b20 C T 7: 33,364,560 G95D probably benign Het
Sec24b A G 3: 129,994,391 V820A probably benign Het
Sim2 A G 16: 94,094,309 D62G possibly damaging Het
Slc17a4 A T 13: 23,900,514 V429D probably benign Het
Sp2 T C 11: 96,961,973 T42A probably damaging Het
Spata3 G A 1: 86,024,447 R141Q unknown Het
Sptbn2 A T 19: 4,745,577 E1658D probably benign Het
Tcaf1 T C 6: 42,678,539 H501R probably benign Het
Tec G A 5: 72,773,835 T262M possibly damaging Het
Timm9 A T 12: 71,125,531 N22K possibly damaging Het
Tln1 C T 4: 43,542,701 probably null Het
Tmbim4 A G 10: 120,217,624 I109M probably benign Het
Tmc7 T C 7: 118,564,343 K110E probably benign Het
Tmem107 C T 11: 69,072,573 P136L probably benign Het
Ttc21b T C 2: 66,231,219 probably null Het
Ubd A C 17: 37,195,444 T74P probably damaging Het
Vps11 A G 9: 44,358,189 V255A possibly damaging Het
Vsnl1 T C 12: 11,326,447 T146A probably benign Het
Wdr38 G T 2: 38,999,972 probably null Het
Yes1 T A 5: 32,684,625 S498T possibly damaging Het
Zc3h13 G A 14: 75,331,883 R1390H probably damaging Het
Other mutations in Zscan4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0628:Zscan4b UTSW 7 10901463 missense probably damaging 0.99
R2289:Zscan4b UTSW 7 10901862 critical splice donor site probably null
R3713:Zscan4b UTSW 7 10901891 missense probably benign 0.01
R6129:Zscan4b UTSW 7 10901888 missense probably benign 0.01
R6393:Zscan4b UTSW 7 10900901 missense possibly damaging 0.76
R7057:Zscan4b UTSW 7 10901709 nonsense probably null
R7312:Zscan4b UTSW 7 10900940 missense probably benign 0.00
R7383:Zscan4b UTSW 7 10904033 missense possibly damaging 0.92
R7412:Zscan4b UTSW 7 10900864 missense probably damaging 1.00
R7412:Zscan4b UTSW 7 10901893 missense probably benign 0.03
R7449:Zscan4b UTSW 7 10904058 missense possibly damaging 0.95
Z1177:Zscan4b UTSW 7 10901737 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TTACCAACTAACCTGTGGCC -3'
(R):5'- GCTCACAGGAACACAAATTTGAG -3'

Sequencing Primer
(F):5'- ACCTGTGGCCAATAATCTATCTTGTG -3'
(R):5'- TGTCTATAGGGACAATGAGTTGAC -3'
Posted On2019-06-07