Incidental Mutation 'PIT4696001:Cyp2a5'
ID556787
Institutional Source Beutler Lab
Gene Symbol Cyp2a5
Ensembl Gene ENSMUSG00000005547
Gene Namecytochrome P450, family 2, subfamily a, polypeptide 5
SynonymsCoh
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #PIT4696001 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location26835305-26843548 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 26840979 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 339 (R339Q)
Ref Sequence ENSEMBL: ENSMUSP00000005685 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005685] [ENSMUST00000168869] [ENSMUST00000169007]
Predicted Effect probably benign
Transcript: ENSMUST00000005685
AA Change: R339Q

PolyPhen 2 Score 0.176 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000005685
Gene: ENSMUSG00000005547
AA Change: R339Q

DomainStartEndE-ValueType
transmembrane domain 5 24 N/A INTRINSIC
Pfam:p450 34 491 4e-151 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168869
SMART Domains Protein: ENSMUSP00000130640
Gene: ENSMUSG00000005547

DomainStartEndE-ValueType
transmembrane domain 5 24 N/A INTRINSIC
PDB:2PG7|D 25 60 9e-14 PDB
SCOP:d1jpza_ 30 60 6e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169007
AA Change: R26Q

PolyPhen 2 Score 0.138 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000128865
Gene: ENSMUSG00000005547
AA Change: R26Q

DomainStartEndE-ValueType
Pfam:p450 1 116 1.1e-47 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000127829
Gene: ENSMUSG00000005547
AA Change: R12Q

DomainStartEndE-ValueType
Pfam:p450 1 59 2.9e-20 PFAM
Coding Region Coverage
  • 1x: 93.5%
  • 3x: 91.0%
  • 10x: 86.2%
  • 20x: 75.9%
Validation Efficiency 100% (57/57)
MGI Phenotype PHENOTYPE: Mice exhibit strain-specific cytochrome activity levels. Mice homozygous for a knock-out allele exhibit slower clearance of nicotine and cotinine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm3 G A 7: 119,784,986 probably null Het
Adam20 T A 8: 40,794,948 Y32N probably benign Het
Adm T C 7: 110,628,289 V4A probably benign Het
Anpep G A 7: 79,839,464 T320I possibly damaging Het
Atp8b1 T C 18: 64,539,270 S1008G possibly damaging Het
B9d1 T A 11: 61,505,243 M12K possibly damaging Het
Cad T C 5: 31,072,094 L1435P probably damaging Het
Cat T C 2: 103,471,812 D180G probably damaging Het
Cntln C T 4: 84,974,000 T374M probably damaging Het
Defa22 T C 8: 21,162,336 L6P probably damaging Het
Dr1 T A 5: 108,269,738 I50K probably damaging Het
Eln C T 5: 134,737,178 G57E unknown Het
Fat4 T C 3: 38,889,004 I682T probably benign Het
Fat4 C A 3: 38,982,357 A3386E probably damaging Het
Fcgr3 T A 1: 171,057,750 Y102F probably damaging Het
Gm5930 A T 14: 44,336,536 L115M probably damaging Het
Herc1 T A 9: 66,479,009 V3748D probably damaging Het
Ino80d A G 1: 63,085,986 S106P probably benign Het
Kcns3 C T 12: 11,092,748 probably benign Het
Kndc1 T A 7: 139,932,917 L1527Q probably damaging Het
Lepr T G 4: 101,779,983 S690A probably benign Het
Lrfn5 T C 12: 61,843,557 F544S probably damaging Het
Mapkap1 C A 2: 34,619,849 H450Q probably damaging Het
Mdm1 A G 10: 118,158,540 T485A probably benign Het
Megf10 T C 18: 57,277,688 C690R probably damaging Het
Myo7a A G 7: 98,063,599 M1723T probably benign Het
Nrip3 A T 7: 109,765,507 C137* probably null Het
Olfr153 T A 2: 87,532,780 I249N probably damaging Het
Pde4a T A 9: 21,211,001 M731K probably benign Het
Pebp1 A G 5: 117,283,462 L117P probably damaging Het
Phc2 T C 4: 128,705,202 Y51H probably damaging Het
Ppp2r5b A G 19: 6,234,683 F50S probably benign Het
Prpf4b A G 13: 34,899,842 S865G probably benign Het
Ptpn5 C T 7: 47,088,606 V243M probably benign Het
Rora T C 9: 69,364,559 L273P possibly damaging Het
Rtp4 T A 16: 23,613,454 S245R probably benign Het
Scgb2b20 C T 7: 33,364,560 G95D probably benign Het
Sec24b A G 3: 129,994,391 V820A probably benign Het
Sim2 A G 16: 94,094,309 D62G possibly damaging Het
Slc17a4 A T 13: 23,900,514 V429D probably benign Het
Sp2 T C 11: 96,961,973 T42A probably damaging Het
Spata3 G A 1: 86,024,447 R141Q unknown Het
Sptbn2 A T 19: 4,745,577 E1658D probably benign Het
Tcaf1 T C 6: 42,678,539 H501R probably benign Het
Tec G A 5: 72,773,835 T262M possibly damaging Het
Timm9 A T 12: 71,125,531 N22K possibly damaging Het
Tln1 C T 4: 43,542,701 probably null Het
Tmbim4 A G 10: 120,217,624 I109M probably benign Het
Tmc7 T C 7: 118,564,343 K110E probably benign Het
Tmem107 C T 11: 69,072,573 P136L probably benign Het
Ttc21b T C 2: 66,231,219 probably null Het
Ubd A C 17: 37,195,444 T74P probably damaging Het
Vps11 A G 9: 44,358,189 V255A possibly damaging Het
Vsnl1 T C 12: 11,326,447 T146A probably benign Het
Wdr38 G T 2: 38,999,972 probably null Het
Yes1 T A 5: 32,684,625 S498T possibly damaging Het
Zc3h13 G A 14: 75,331,883 R1390H probably damaging Het
Zscan4b A G 7: 10,902,022 V126A possibly damaging Het
Other mutations in Cyp2a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01354:Cyp2a5 APN 7 26837103 missense possibly damaging 0.82
IGL01744:Cyp2a5 APN 7 26841009 missense probably damaging 1.00
IGL02155:Cyp2a5 APN 7 26843046 missense probably benign 0.06
IGL03076:Cyp2a5 APN 7 26835874 missense probably damaging 0.99
R0762:Cyp2a5 UTSW 7 26838873 nonsense probably null
R0980:Cyp2a5 UTSW 7 26839006 splice site probably null
R1078:Cyp2a5 UTSW 7 26835541 missense probably benign 0.33
R1511:Cyp2a5 UTSW 7 26835936 missense probably damaging 1.00
R1780:Cyp2a5 UTSW 7 26841876 intron probably benign
R1803:Cyp2a5 UTSW 7 26835546 splice site probably null
R1899:Cyp2a5 UTSW 7 26839033 nonsense probably null
R1977:Cyp2a5 UTSW 7 26835922 missense probably benign 0.15
R2215:Cyp2a5 UTSW 7 26840475 missense probably damaging 1.00
R2258:Cyp2a5 UTSW 7 26837103 missense possibly damaging 0.82
R3051:Cyp2a5 UTSW 7 26842985 missense possibly damaging 0.77
R3052:Cyp2a5 UTSW 7 26842985 missense possibly damaging 0.77
R3053:Cyp2a5 UTSW 7 26842985 missense possibly damaging 0.77
R4387:Cyp2a5 UTSW 7 26841054 missense probably damaging 0.97
R4832:Cyp2a5 UTSW 7 26835545 critical splice donor site probably null
R5054:Cyp2a5 UTSW 7 26841104 missense probably damaging 1.00
R5622:Cyp2a5 UTSW 7 26835874 missense probably damaging 1.00
R5867:Cyp2a5 UTSW 7 26842958 missense probably benign 0.09
R5998:Cyp2a5 UTSW 7 26837153 missense probably benign 0.00
R6186:Cyp2a5 UTSW 7 26843388 unclassified probably benign
R7338:Cyp2a5 UTSW 7 26842947 missense probably damaging 1.00
R7350:Cyp2a5 UTSW 7 26836783 missense probably benign 0.37
R7536:Cyp2a5 UTSW 7 26840478 missense probably damaging 1.00
R7722:Cyp2a5 UTSW 7 26837118 missense probably benign 0.31
R7831:Cyp2a5 UTSW 7 26835515 missense possibly damaging 0.71
R7983:Cyp2a5 UTSW 7 26840441 missense probably benign 0.40
R8805:Cyp2a5 UTSW 7 26841105 missense probably damaging 0.99
Z1088:Cyp2a5 UTSW 7 26841107 missense probably damaging 1.00
Z1176:Cyp2a5 UTSW 7 26835497 missense probably damaging 1.00
Z1176:Cyp2a5 UTSW 7 26836774 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGTTTCACCAATGCATGATTTG -3'
(R):5'- CTGGGTGGACTCTAATGAGGAG -3'

Sequencing Primer
(F):5'- GCATGTTGTGAAAATGATCTACAATG -3'
(R):5'- AAGGTCCTAGAGGCCCATG -3'
Posted On2019-06-07