Incidental Mutation 'R0605:Phf20l1'
ID 55679
Institutional Source Beutler Lab
Gene Symbol Phf20l1
Ensembl Gene ENSMUSG00000072501
Gene Name PHD finger protein 20-like 1
Synonyms E130113K22Rik, CGI-72
MMRRC Submission 038794-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.211) question?
Stock # R0605 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 66449409-66519825 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 66466971 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Arginine at position 88 (K88R)
Ref Sequence ENSEMBL: ENSMUSP00000155465 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048188] [ENSMUST00000229160] [ENSMUST00000229576] [ENSMUST00000230882] [ENSMUST00000230948]
AlphaFold Q8CCJ9
Predicted Effect possibly damaging
Transcript: ENSMUST00000048188
AA Change: K88R

PolyPhen 2 Score 0.606 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000035682
Gene: ENSMUSG00000072501
AA Change: K88R

DomainStartEndE-ValueType
TUDOR 11 71 7.67e0 SMART
Agenet 11 73 3.53e0 SMART
Agenet 85 141 4.54e-1 SMART
TUDOR 85 141 5.75e-8 SMART
Pfam:DUF3776 210 319 1.3e-31 PFAM
Pfam:PHD20L1_u1 318 413 4.7e-47 PFAM
low complexity region 443 453 N/A INTRINSIC
low complexity region 530 543 N/A INTRINSIC
low complexity region 547 585 N/A INTRINSIC
low complexity region 598 608 N/A INTRINSIC
low complexity region 642 658 N/A INTRINSIC
PHD 683 727 8.45e-3 SMART
low complexity region 879 887 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000229160
AA Change: K88R

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000229576
AA Change: K88R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229590
Predicted Effect probably damaging
Transcript: ENSMUST00000230882
AA Change: K88R

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230915
Predicted Effect probably damaging
Transcript: ENSMUST00000230948
AA Change: K88R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.0701 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.4%
Validation Efficiency 100% (85/85)
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933406P04Rik G A 10: 20,186,973 (GRCm39) probably benign Het
Adam28 A T 14: 68,844,049 (GRCm39) probably benign Het
Adamts3 A G 5: 90,009,334 (GRCm39) W110R possibly damaging Het
Add1 T C 5: 34,771,568 (GRCm39) V342A possibly damaging Het
Aff3 A G 1: 38,249,068 (GRCm39) S680P probably damaging Het
Ak9 T C 10: 41,221,135 (GRCm39) Y322H probably damaging Het
Als2 A G 1: 59,207,573 (GRCm39) L1528S probably benign Het
Ass1 A T 2: 31,404,831 (GRCm39) N371Y probably damaging Het
Atp6v1a A C 16: 43,931,859 (GRCm39) probably null Het
Bpi T C 2: 158,103,314 (GRCm39) L103P probably damaging Het
Cd80 G A 16: 38,303,056 (GRCm39) V168I probably benign Het
Cfh T C 1: 140,030,096 (GRCm39) S926G probably damaging Het
Chrd A T 16: 20,554,189 (GRCm39) T304S probably damaging Het
Chsy3 A G 18: 59,542,125 (GRCm39) Y421C probably damaging Het
Cmbl T G 15: 31,585,455 (GRCm39) V101G probably damaging Het
Colgalt2 T A 1: 152,371,543 (GRCm39) probably benign Het
Coq4 C T 2: 29,680,010 (GRCm39) Q101* probably null Het
Cr2 T C 1: 194,845,904 (GRCm39) probably benign Het
Cry1 T C 10: 85,020,223 (GRCm39) D38G probably damaging Het
Dmxl2 T C 9: 54,327,229 (GRCm39) D758G probably benign Het
Epsti1 C T 14: 78,164,677 (GRCm39) probably benign Het
Fam24b T C 7: 130,928,915 (GRCm39) probably benign Het
Fem1c G A 18: 46,638,227 (GRCm39) R592C probably benign Het
Foxred1 T C 9: 35,116,178 (GRCm39) Y490C possibly damaging Het
Gm9875 A G 2: 13,562,699 (GRCm39) K9R unknown Het
Grid2ip T C 5: 143,365,117 (GRCm39) S322P probably damaging Het
Gucy1b2 A G 14: 62,640,608 (GRCm39) probably benign Het
Hmcn1 A T 1: 150,533,127 (GRCm39) probably null Het
Hpdl C T 4: 116,677,984 (GRCm39) S159N possibly damaging Het
Hsd17b12 A T 2: 93,863,987 (GRCm39) M285K probably benign Het
Icam5 T C 9: 20,943,493 (GRCm39) I23T probably benign Het
Kat5 A G 19: 5,658,364 (GRCm39) probably benign Het
Lama3 A G 18: 12,640,006 (GRCm39) N67S probably benign Het
Lamb2 T C 9: 108,363,304 (GRCm39) probably benign Het
Lgals3bp A G 11: 118,284,220 (GRCm39) F453S probably damaging Het
Lypd4 A G 7: 24,564,800 (GRCm39) Y113H probably damaging Het
Mdm1 C T 10: 117,982,506 (GRCm39) T47M probably damaging Het
Mei1 C A 15: 81,954,351 (GRCm39) T52K probably benign Het
Meiob G A 17: 25,037,236 (GRCm39) probably benign Het
Ndufaf6 A G 4: 11,051,224 (GRCm39) V292A probably damaging Het
Neb T A 2: 52,154,038 (GRCm39) M2358L possibly damaging Het
Nlrp1b A G 11: 71,047,005 (GRCm39) S1119P possibly damaging Het
Nsmaf A G 4: 6,418,470 (GRCm39) probably null Het
Ogfod1 T C 8: 94,773,895 (GRCm39) probably benign Het
Or5ae2 T C 7: 84,506,345 (GRCm39) I256T probably damaging Het
Or8h7 T C 2: 86,720,763 (GRCm39) Y252C possibly damaging Het
Or9s14 G T 1: 92,535,618 (GRCm39) V20L probably benign Het
Osbpl1a T A 18: 13,015,336 (GRCm39) probably null Het
Otud7b T A 3: 96,052,270 (GRCm39) probably benign Het
P3h3 T A 6: 124,832,998 (GRCm39) H185L probably damaging Het
P4htm G A 9: 108,460,923 (GRCm39) A183V probably null Het
Peak1 C T 9: 56,134,382 (GRCm39) probably benign Het
Phlpp2 A G 8: 110,659,843 (GRCm39) N721S probably benign Het
Plagl2 T C 2: 153,077,864 (GRCm39) K39R probably benign Het
Plppr1 A T 4: 49,323,466 (GRCm39) N252I probably damaging Het
Pom121l2 C T 13: 22,166,206 (GRCm39) A159V probably damaging Het
Prom2 C A 2: 127,381,915 (GRCm39) probably null Het
Prrc2c T C 1: 162,509,995 (GRCm39) T1017A probably damaging Het
Rimbp3 G T 16: 17,029,563 (GRCm39) A996S probably damaging Het
Rnf213 A G 11: 119,322,543 (GRCm39) T1387A probably benign Het
Scaper A T 9: 55,722,802 (GRCm39) probably benign Het
Scara5 A G 14: 65,997,097 (GRCm39) E403G possibly damaging Het
Scrib T C 15: 75,939,402 (GRCm39) I94V possibly damaging Het
Shank3 T C 15: 89,408,350 (GRCm39) F67L possibly damaging Het
Shprh T C 10: 11,082,856 (GRCm39) F1562L probably damaging Het
Src C T 2: 157,311,841 (GRCm39) T529M probably damaging Het
Sycp2l T A 13: 41,296,942 (GRCm39) M341K probably benign Het
Syde1 T C 10: 78,424,929 (GRCm39) probably benign Het
Tars3 A T 7: 65,327,819 (GRCm39) R509S probably damaging Het
Tle6 T A 10: 81,430,180 (GRCm39) H324L probably damaging Het
Tnfaip8 ACTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC ACTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC 18: 50,179,912 (GRCm39) probably benign Het
Tnfrsf14 T A 4: 155,009,837 (GRCm39) K115* probably null Het
Trappc10 T C 10: 78,037,331 (GRCm39) N824S possibly damaging Het
Tsc1 C T 2: 28,561,790 (GRCm39) S309F probably damaging Het
Ttc21a A G 9: 119,790,908 (GRCm39) I885V possibly damaging Het
Ttn C T 2: 76,570,797 (GRCm39) A26699T probably damaging Het
Ttn T C 2: 76,778,715 (GRCm39) Y1262C unknown Het
Usp49 T C 17: 47,985,851 (GRCm39) probably null Het
Vmn1r226 A T 17: 20,908,133 (GRCm39) T122S probably benign Het
Vps8 A T 16: 21,378,087 (GRCm39) T1033S probably benign Het
Vwf C A 6: 125,662,800 (GRCm39) T2728K probably benign Het
Wdr5b T C 16: 35,862,366 (GRCm39) S162P probably benign Het
Xrn1 C T 9: 95,908,930 (GRCm39) Q1235* probably null Het
Zfp1005 A G 2: 150,110,523 (GRCm39) I404M unknown Het
Other mutations in Phf20l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Phf20l1 APN 15 66,500,884 (GRCm39) missense probably benign 0.28
IGL00484:Phf20l1 APN 15 66,487,482 (GRCm39) splice site probably benign
IGL00668:Phf20l1 APN 15 66,504,698 (GRCm39) missense probably damaging 0.99
IGL00849:Phf20l1 APN 15 66,508,681 (GRCm39) missense probably benign 0.00
IGL00954:Phf20l1 APN 15 66,513,757 (GRCm39) missense probably damaging 1.00
IGL01025:Phf20l1 APN 15 66,484,981 (GRCm39) missense probably damaging 1.00
IGL01504:Phf20l1 APN 15 66,469,540 (GRCm39) missense possibly damaging 0.73
IGL02087:Phf20l1 APN 15 66,500,840 (GRCm39) missense probably damaging 1.00
IGL02273:Phf20l1 APN 15 66,511,874 (GRCm39) missense probably damaging 1.00
IGL02276:Phf20l1 APN 15 66,487,259 (GRCm39) critical splice donor site probably null
IGL02372:Phf20l1 APN 15 66,513,650 (GRCm39) missense probably damaging 1.00
IGL02589:Phf20l1 APN 15 66,487,481 (GRCm39) splice site probably benign
IGL02656:Phf20l1 APN 15 66,501,676 (GRCm39) missense probably damaging 1.00
IGL02691:Phf20l1 APN 15 66,476,713 (GRCm39) missense probably damaging 1.00
IGL02881:Phf20l1 APN 15 66,466,829 (GRCm39) critical splice donor site probably null
IGL02940:Phf20l1 APN 15 66,467,000 (GRCm39) missense probably damaging 1.00
IGL02943:Phf20l1 APN 15 66,466,733 (GRCm39) missense probably damaging 1.00
IGL03030:Phf20l1 APN 15 66,513,796 (GRCm39) utr 3 prime probably benign
IGL03034:Phf20l1 APN 15 66,469,252 (GRCm39) missense probably damaging 1.00
Abbreviated UTSW 15 66,504,752 (GRCm39) critical splice donor site probably null
acadia UTSW 15 66,508,669 (GRCm39) missense possibly damaging 0.85
curt UTSW 15 66,511,797 (GRCm39) missense possibly damaging 0.90
Cut UTSW 15 66,484,888 (GRCm39) nonsense probably null
shorthand UTSW 15 66,481,396 (GRCm39) missense probably damaging 1.00
slang UTSW 15 66,513,781 (GRCm39) missense probably benign 0.03
PIT4305001:Phf20l1 UTSW 15 66,484,901 (GRCm39) missense possibly damaging 0.94
R0070:Phf20l1 UTSW 15 66,511,840 (GRCm39) missense probably damaging 1.00
R0070:Phf20l1 UTSW 15 66,511,840 (GRCm39) missense probably damaging 1.00
R0562:Phf20l1 UTSW 15 66,481,453 (GRCm39) missense probably damaging 1.00
R0787:Phf20l1 UTSW 15 66,487,479 (GRCm39) splice site probably benign
R1458:Phf20l1 UTSW 15 66,476,662 (GRCm39) missense probably damaging 1.00
R1619:Phf20l1 UTSW 15 66,487,108 (GRCm39) missense possibly damaging 0.88
R1781:Phf20l1 UTSW 15 66,504,674 (GRCm39) missense probably damaging 1.00
R2360:Phf20l1 UTSW 15 66,466,769 (GRCm39) missense probably damaging 1.00
R3973:Phf20l1 UTSW 15 66,513,665 (GRCm39) missense probably damaging 1.00
R4374:Phf20l1 UTSW 15 66,476,686 (GRCm39) missense possibly damaging 0.72
R4375:Phf20l1 UTSW 15 66,487,071 (GRCm39) missense probably benign 0.00
R4554:Phf20l1 UTSW 15 66,469,216 (GRCm39) missense probably damaging 1.00
R4913:Phf20l1 UTSW 15 66,476,704 (GRCm39) missense probably benign 0.03
R5092:Phf20l1 UTSW 15 66,508,762 (GRCm39) missense possibly damaging 0.46
R5491:Phf20l1 UTSW 15 66,487,634 (GRCm39) missense possibly damaging 0.67
R5713:Phf20l1 UTSW 15 66,508,669 (GRCm39) missense possibly damaging 0.85
R6126:Phf20l1 UTSW 15 66,508,673 (GRCm39) missense probably benign 0.02
R6213:Phf20l1 UTSW 15 66,504,752 (GRCm39) critical splice donor site probably null
R6569:Phf20l1 UTSW 15 66,501,673 (GRCm39) missense probably damaging 1.00
R6572:Phf20l1 UTSW 15 66,481,396 (GRCm39) missense probably damaging 1.00
R6808:Phf20l1 UTSW 15 66,502,762 (GRCm39) missense probably damaging 0.99
R7100:Phf20l1 UTSW 15 66,476,689 (GRCm39) missense probably benign 0.01
R7208:Phf20l1 UTSW 15 66,476,638 (GRCm39) missense probably benign 0.05
R7436:Phf20l1 UTSW 15 66,469,599 (GRCm39) missense possibly damaging 0.92
R7466:Phf20l1 UTSW 15 66,508,733 (GRCm39) missense probably damaging 1.00
R7604:Phf20l1 UTSW 15 66,475,933 (GRCm39) missense probably benign 0.02
R7863:Phf20l1 UTSW 15 66,487,084 (GRCm39) missense possibly damaging 0.94
R7991:Phf20l1 UTSW 15 66,502,768 (GRCm39) missense possibly damaging 0.64
R8015:Phf20l1 UTSW 15 66,511,797 (GRCm39) missense possibly damaging 0.90
R8161:Phf20l1 UTSW 15 66,475,922 (GRCm39) missense probably damaging 1.00
R8228:Phf20l1 UTSW 15 66,511,789 (GRCm39) missense possibly damaging 0.81
R8857:Phf20l1 UTSW 15 66,513,781 (GRCm39) missense probably benign 0.03
R9295:Phf20l1 UTSW 15 66,513,752 (GRCm39) missense probably damaging 1.00
R9393:Phf20l1 UTSW 15 66,475,955 (GRCm39) missense probably damaging 1.00
R9442:Phf20l1 UTSW 15 66,484,888 (GRCm39) nonsense probably null
R9522:Phf20l1 UTSW 15 66,504,669 (GRCm39) missense possibly damaging 0.89
R9727:Phf20l1 UTSW 15 66,487,231 (GRCm39) missense probably benign 0.01
X0065:Phf20l1 UTSW 15 66,501,655 (GRCm39) nonsense probably null
X0065:Phf20l1 UTSW 15 66,469,527 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACCCCTTGAGAGACCTGCACTAAG -3'
(R):5'- GCTGGGAAGTCATGAGTCATGTCAC -3'

Sequencing Primer
(F):5'- TTGAGAGACCTGCACTAAGGAAAG -3'
(R):5'- GAGAGTACTAACAGAAAATCCACAC -3'
Posted On 2013-07-11