Incidental Mutation 'PIT4696001:Anpep'
ID556790
Institutional Source Beutler Lab
Gene Symbol Anpep
Ensembl Gene ENSMUSG00000039062
Gene Namealanyl (membrane) aminopeptidase
Synonymsaminopeptidase N, Cd13, Apn
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #PIT4696001 (G1)
Quality Score210.009
Status Validated
Chromosome7
Chromosomal Location79821803-79861059 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 79839464 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 320 (T320I)
Ref Sequence ENSEMBL: ENSMUSP00000035943 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049004] [ENSMUST00000107392] [ENSMUST00000205502] [ENSMUST00000206235]
Predicted Effect possibly damaging
Transcript: ENSMUST00000049004
AA Change: T320I

PolyPhen 2 Score 0.854 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000035943
Gene: ENSMUSG00000039062
AA Change: T320I

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
low complexity region 44 64 N/A INTRINSIC
Pfam:Peptidase_M1 75 479 6.3e-142 PFAM
Pfam:Peptidase_MA_2 355 502 1.4e-21 PFAM
Pfam:ERAP1_C 618 944 2.9e-45 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000107392
AA Change: T320I

PolyPhen 2 Score 0.854 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000103015
Gene: ENSMUSG00000039062
AA Change: T320I

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
low complexity region 44 64 N/A INTRINSIC
Pfam:Peptidase_M1 75 479 2.5e-139 PFAM
Pfam:ERAP1_C 618 943 2e-73 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205502
Predicted Effect probably benign
Transcript: ENSMUST00000206235
Coding Region Coverage
  • 1x: 93.5%
  • 3x: 91.0%
  • 10x: 86.2%
  • 20x: 75.9%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Aminopeptidase N is located in the small-intestinal and renal microvillar membrane, and also in other plasma membranes. In the small intestine aminopeptidase N plays a role in the final digestion of peptides generated from hydrolysis of proteins by gastric and pancreatic proteases. Its function in proximal tubular epithelial cells and other cell types is less clear. The large extracellular carboxyterminal domain contains a pentapeptide consensus sequence characteristic of members of the zinc-binding metalloproteinase superfamily. Sequence comparisons with known enzymes of this class showed that CD13 and aminopeptidase N are identical. The latter enzyme was thought to be involved in the metabolism of regulatory peptides by diverse cell types, including small intestinal and renal tubular epithelial cells, macrophages, granulocytes, and synaptic membranes from the CNS. Human aminopeptidase N is a receptor for one strain of human coronavirus that is an important cause of upper respiratory tract infections. Defects in this gene appear to be a cause of various types of leukemia or lymphoma. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for different knock-out alleles exhibit an increase in CD4+ thymocytes, altered macrophage adhesion, pathological neovascularization and/or altered mammary gland morphology during gestation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm3 G A 7: 119,784,986 probably null Het
Adam20 T A 8: 40,794,948 Y32N probably benign Het
Adm T C 7: 110,628,289 V4A probably benign Het
Atp8b1 T C 18: 64,539,270 S1008G possibly damaging Het
B9d1 T A 11: 61,505,243 M12K possibly damaging Het
Cad T C 5: 31,072,094 L1435P probably damaging Het
Cat T C 2: 103,471,812 D180G probably damaging Het
Cntln C T 4: 84,974,000 T374M probably damaging Het
Cyp2a5 G A 7: 26,840,979 R339Q probably benign Het
Defa22 T C 8: 21,162,336 L6P probably damaging Het
Dr1 T A 5: 108,269,738 I50K probably damaging Het
Eln C T 5: 134,737,178 G57E unknown Het
Fat4 T C 3: 38,889,004 I682T probably benign Het
Fat4 C A 3: 38,982,357 A3386E probably damaging Het
Fcgr3 T A 1: 171,057,750 Y102F probably damaging Het
Gm5930 A T 14: 44,336,536 L115M probably damaging Het
Herc1 T A 9: 66,479,009 V3748D probably damaging Het
Ino80d A G 1: 63,085,986 S106P probably benign Het
Kcns3 C T 12: 11,092,748 probably benign Het
Kndc1 T A 7: 139,932,917 L1527Q probably damaging Het
Lepr T G 4: 101,779,983 S690A probably benign Het
Lrfn5 T C 12: 61,843,557 F544S probably damaging Het
Mapkap1 C A 2: 34,619,849 H450Q probably damaging Het
Mdm1 A G 10: 118,158,540 T485A probably benign Het
Megf10 T C 18: 57,277,688 C690R probably damaging Het
Myo7a A G 7: 98,063,599 M1723T probably benign Het
Nrip3 A T 7: 109,765,507 C137* probably null Het
Olfr153 T A 2: 87,532,780 I249N probably damaging Het
Pde4a T A 9: 21,211,001 M731K probably benign Het
Pebp1 A G 5: 117,283,462 L117P probably damaging Het
Phc2 T C 4: 128,705,202 Y51H probably damaging Het
Ppp2r5b A G 19: 6,234,683 F50S probably benign Het
Prpf4b A G 13: 34,899,842 S865G probably benign Het
Ptpn5 C T 7: 47,088,606 V243M probably benign Het
Rora T C 9: 69,364,559 L273P possibly damaging Het
Rtp4 T A 16: 23,613,454 S245R probably benign Het
Scgb2b20 C T 7: 33,364,560 G95D probably benign Het
Sec24b A G 3: 129,994,391 V820A probably benign Het
Sim2 A G 16: 94,094,309 D62G possibly damaging Het
Slc17a4 A T 13: 23,900,514 V429D probably benign Het
Sp2 T C 11: 96,961,973 T42A probably damaging Het
Spata3 G A 1: 86,024,447 R141Q unknown Het
Sptbn2 A T 19: 4,745,577 E1658D probably benign Het
Tcaf1 T C 6: 42,678,539 H501R probably benign Het
Tec G A 5: 72,773,835 T262M possibly damaging Het
Timm9 A T 12: 71,125,531 N22K possibly damaging Het
Tln1 C T 4: 43,542,701 probably null Het
Tmbim4 A G 10: 120,217,624 I109M probably benign Het
Tmc7 T C 7: 118,564,343 K110E probably benign Het
Tmem107 C T 11: 69,072,573 P136L probably benign Het
Ttc21b T C 2: 66,231,219 probably null Het
Ubd A C 17: 37,195,444 T74P probably damaging Het
Vps11 A G 9: 44,358,189 V255A possibly damaging Het
Vsnl1 T C 12: 11,326,447 T146A probably benign Het
Wdr38 G T 2: 38,999,972 probably null Het
Yes1 T A 5: 32,684,625 S498T possibly damaging Het
Zc3h13 G A 14: 75,331,883 R1390H probably damaging Het
Zscan4b A G 7: 10,902,022 V126A possibly damaging Het
Other mutations in Anpep
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Anpep APN 7 79825736 missense possibly damaging 0.64
IGL00089:Anpep APN 7 79841986 missense probably damaging 1.00
IGL00767:Anpep APN 7 79840890 missense probably benign 0.00
IGL00901:Anpep APN 7 79839423 missense probably benign
IGL01919:Anpep APN 7 79825350 missense possibly damaging 0.77
IGL02049:Anpep APN 7 79835181 missense probably damaging 0.97
IGL02195:Anpep APN 7 79826685 missense probably damaging 1.00
IGL02210:Anpep APN 7 79826904 missense probably benign 0.00
IGL02584:Anpep APN 7 79825393 splice site probably benign
IGL02677:Anpep APN 7 79838730 missense probably damaging 1.00
IGL03073:Anpep APN 7 79838955 missense probably damaging 1.00
IGL03100:Anpep APN 7 79836361 missense probably benign 0.01
R0329:Anpep UTSW 7 79838256 missense probably benign 0.01
R0330:Anpep UTSW 7 79838256 missense probably benign 0.01
R0619:Anpep UTSW 7 79841009 missense probably benign
R0691:Anpep UTSW 7 79839299 missense probably damaging 0.98
R1004:Anpep UTSW 7 79838256 missense probably benign 0.01
R1005:Anpep UTSW 7 79838256 missense probably benign 0.01
R1274:Anpep UTSW 7 79838256 missense probably benign 0.01
R1288:Anpep UTSW 7 79838256 missense probably benign 0.01
R1289:Anpep UTSW 7 79838256 missense probably benign 0.01
R1532:Anpep UTSW 7 79826948 nonsense probably null
R1540:Anpep UTSW 7 79838256 missense probably benign 0.01
R1574:Anpep UTSW 7 79838407 splice site probably null
R1574:Anpep UTSW 7 79838407 splice site probably null
R1618:Anpep UTSW 7 79835417 missense probably benign 0.00
R1627:Anpep UTSW 7 79842011 missense probably benign
R1693:Anpep UTSW 7 79838256 missense probably benign 0.01
R1717:Anpep UTSW 7 79838256 missense probably benign 0.01
R1745:Anpep UTSW 7 79838256 missense probably benign 0.01
R1746:Anpep UTSW 7 79838256 missense probably benign 0.01
R1748:Anpep UTSW 7 79838256 missense probably benign 0.01
R1809:Anpep UTSW 7 79841823 missense probably benign 0.01
R1901:Anpep UTSW 7 79838256 missense probably benign 0.01
R1902:Anpep UTSW 7 79838256 missense probably benign 0.01
R1903:Anpep UTSW 7 79838256 missense probably benign 0.01
R1985:Anpep UTSW 7 79840857 unclassified probably null
R2379:Anpep UTSW 7 79841218 missense probably benign 0.28
R2508:Anpep UTSW 7 79838291 missense possibly damaging 0.80
R3110:Anpep UTSW 7 79841972 missense probably benign 0.15
R3112:Anpep UTSW 7 79841972 missense probably benign 0.15
R3898:Anpep UTSW 7 79839225 missense probably benign 0.07
R3899:Anpep UTSW 7 79839225 missense probably benign 0.07
R3900:Anpep UTSW 7 79839225 missense probably benign 0.07
R4211:Anpep UTSW 7 79840996 nonsense probably null
R4701:Anpep UTSW 7 79839465 missense probably benign 0.16
R4716:Anpep UTSW 7 79826632 missense probably benign 0.00
R5020:Anpep UTSW 7 79833727 missense probably benign
R5042:Anpep UTSW 7 79839469 missense probably benign 0.00
R5084:Anpep UTSW 7 79826870 critical splice donor site probably null
R5319:Anpep UTSW 7 79841731 missense probably benign
R5593:Anpep UTSW 7 79842046 missense probably benign 0.04
R5778:Anpep UTSW 7 79836391 missense probably benign 0.00
R5852:Anpep UTSW 7 79838972 nonsense probably null
R5906:Anpep UTSW 7 79833675 missense probably benign
R6164:Anpep UTSW 7 79842205 missense possibly damaging 0.68
R6254:Anpep UTSW 7 79839233 missense probably damaging 1.00
R6284:Anpep UTSW 7 79825802 missense probably damaging 1.00
R6380:Anpep UTSW 7 79841896 missense probably benign 0.04
R6594:Anpep UTSW 7 79841361 intron probably null
R6746:Anpep UTSW 7 79839185 intron probably null
R6920:Anpep UTSW 7 79825349 missense probably damaging 1.00
R7060:Anpep UTSW 7 79841794 missense probably benign 0.33
R7072:Anpep UTSW 7 79835379 missense possibly damaging 0.58
R7095:Anpep UTSW 7 79842202 missense possibly damaging 0.87
R7102:Anpep UTSW 7 79836313 missense probably benign 0.00
R7178:Anpep UTSW 7 79840988 missense probably benign
R7223:Anpep UTSW 7 79825310 missense probably damaging 1.00
R7344:Anpep UTSW 7 79838650 missense possibly damaging 0.60
R7441:Anpep UTSW 7 79827644 missense possibly damaging 0.93
R7479:Anpep UTSW 7 79835370 missense probably benign 0.11
R7503:Anpep UTSW 7 79826637 missense probably damaging 1.00
R7683:Anpep UTSW 7 79839198 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCAAAGACCAGGGAGCTCTC -3'
(R):5'- GTTGGTCTCCATCCTGACTTATCAG -3'

Sequencing Primer
(F):5'- ATGGCTCCAGCGTTGAAGTC -3'
(R):5'- TGACTTATCAGGGACCTCTAGC -3'
Posted On2019-06-07