Incidental Mutation 'PIT4696001:Kndc1'
ID556795
Institutional Source Beutler Lab
Gene Symbol Kndc1
Ensembl Gene ENSMUSG00000066129
Gene Namekinase non-catalytic C-lobe domain (KIND) containing 1
SynonymsB830014K08Rik, 2410012C07Rik, very-kind, VKIND
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #PIT4696001 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location139894696-139941537 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 139932917 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 1527 (L1527Q)
Ref Sequence ENSEMBL: ENSMUSP00000050586 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053445]
Predicted Effect probably damaging
Transcript: ENSMUST00000053445
AA Change: L1527Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000050586
Gene: ENSMUSG00000066129
AA Change: L1527Q

DomainStartEndE-ValueType
KIND 37 217 4.66e-65 SMART
Blast:KIND 381 454 2e-10 BLAST
KIND 456 620 1.22e-50 SMART
low complexity region 658 670 N/A INTRINSIC
low complexity region 755 771 N/A INTRINSIC
low complexity region 792 801 N/A INTRINSIC
low complexity region 949 965 N/A INTRINSIC
coiled coil region 1121 1151 N/A INTRINSIC
Pfam:RasGEF_N 1242 1341 2.2e-17 PFAM
Pfam:RasGEF 1464 1672 3.8e-22 PFAM
Coding Region Coverage
  • 1x: 93.5%
  • 3x: 91.0%
  • 10x: 86.2%
  • 20x: 75.9%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a Ras guanine nucleotide exchange factor that appears to negatively regulate dendritic growth in the brain. Knockdown of this gene in senescent umbilical vein endothelial cells partially reversed the senescence, showing that this gene could potentially be targeted by anti-aging therapies. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and overtly normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm3 G A 7: 119,784,986 probably null Het
Adam20 T A 8: 40,794,948 Y32N probably benign Het
Adm T C 7: 110,628,289 V4A probably benign Het
Anpep G A 7: 79,839,464 T320I possibly damaging Het
Atp8b1 T C 18: 64,539,270 S1008G possibly damaging Het
B9d1 T A 11: 61,505,243 M12K possibly damaging Het
Cad T C 5: 31,072,094 L1435P probably damaging Het
Cat T C 2: 103,471,812 D180G probably damaging Het
Cntln C T 4: 84,974,000 T374M probably damaging Het
Cyp2a5 G A 7: 26,840,979 R339Q probably benign Het
Defa22 T C 8: 21,162,336 L6P probably damaging Het
Dr1 T A 5: 108,269,738 I50K probably damaging Het
Eln C T 5: 134,737,178 G57E unknown Het
Fat4 T C 3: 38,889,004 I682T probably benign Het
Fat4 C A 3: 38,982,357 A3386E probably damaging Het
Fcgr3 T A 1: 171,057,750 Y102F probably damaging Het
Gm5930 A T 14: 44,336,536 L115M probably damaging Het
Herc1 T A 9: 66,479,009 V3748D probably damaging Het
Ino80d A G 1: 63,085,986 S106P probably benign Het
Kcns3 C T 12: 11,092,748 probably benign Het
Lepr T G 4: 101,779,983 S690A probably benign Het
Lrfn5 T C 12: 61,843,557 F544S probably damaging Het
Mapkap1 C A 2: 34,619,849 H450Q probably damaging Het
Mdm1 A G 10: 118,158,540 T485A probably benign Het
Megf10 T C 18: 57,277,688 C690R probably damaging Het
Myo7a A G 7: 98,063,599 M1723T probably benign Het
Nrip3 A T 7: 109,765,507 C137* probably null Het
Olfr153 T A 2: 87,532,780 I249N probably damaging Het
Pde4a T A 9: 21,211,001 M731K probably benign Het
Pebp1 A G 5: 117,283,462 L117P probably damaging Het
Phc2 T C 4: 128,705,202 Y51H probably damaging Het
Ppp2r5b A G 19: 6,234,683 F50S probably benign Het
Prpf4b A G 13: 34,899,842 S865G probably benign Het
Ptpn5 C T 7: 47,088,606 V243M probably benign Het
Rora T C 9: 69,364,559 L273P possibly damaging Het
Rtp4 T A 16: 23,613,454 S245R probably benign Het
Scgb2b20 C T 7: 33,364,560 G95D probably benign Het
Sec24b A G 3: 129,994,391 V820A probably benign Het
Sim2 A G 16: 94,094,309 D62G possibly damaging Het
Slc17a4 A T 13: 23,900,514 V429D probably benign Het
Sp2 T C 11: 96,961,973 T42A probably damaging Het
Spata3 G A 1: 86,024,447 R141Q unknown Het
Sptbn2 A T 19: 4,745,577 E1658D probably benign Het
Tcaf1 T C 6: 42,678,539 H501R probably benign Het
Tec G A 5: 72,773,835 T262M possibly damaging Het
Timm9 A T 12: 71,125,531 N22K possibly damaging Het
Tln1 C T 4: 43,542,701 probably null Het
Tmbim4 A G 10: 120,217,624 I109M probably benign Het
Tmc7 T C 7: 118,564,343 K110E probably benign Het
Tmem107 C T 11: 69,072,573 P136L probably benign Het
Ttc21b T C 2: 66,231,219 probably null Het
Ubd A C 17: 37,195,444 T74P probably damaging Het
Vps11 A G 9: 44,358,189 V255A possibly damaging Het
Vsnl1 T C 12: 11,326,447 T146A probably benign Het
Wdr38 G T 2: 38,999,972 probably null Het
Yes1 T A 5: 32,684,625 S498T possibly damaging Het
Zc3h13 G A 14: 75,331,883 R1390H probably damaging Het
Zscan4b A G 7: 10,902,022 V126A possibly damaging Het
Other mutations in Kndc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Kndc1 APN 7 139901988 splice site probably benign
IGL01061:Kndc1 APN 7 139922694 missense probably benign 0.00
IGL01099:Kndc1 APN 7 139920784 missense probably damaging 1.00
IGL01522:Kndc1 APN 7 139913972 splice site probably benign
IGL01767:Kndc1 APN 7 139930046 missense probably damaging 1.00
IGL01884:Kndc1 APN 7 139914194 missense probably damaging 1.00
IGL01932:Kndc1 APN 7 139923790 missense probably damaging 0.98
IGL02133:Kndc1 APN 7 139920767 missense probably benign 0.19
IGL02411:Kndc1 APN 7 139921913 critical splice donor site probably null
IGL02472:Kndc1 APN 7 139910901 missense probably benign 0.01
IGL02537:Kndc1 APN 7 139910410 missense probably benign 0.01
IGL02708:Kndc1 APN 7 139901181 missense probably damaging 1.00
IGL03115:Kndc1 APN 7 139921509 missense probably benign 0.28
IGL03160:Kndc1 APN 7 139920689 nonsense probably null
IGL03138:Kndc1 UTSW 7 139939878 missense possibly damaging 0.89
PIT4142001:Kndc1 UTSW 7 139923776 frame shift probably null
R0349:Kndc1 UTSW 7 139910304 missense probably benign 0.00
R0384:Kndc1 UTSW 7 139910599 missense possibly damaging 0.85
R0415:Kndc1 UTSW 7 139930124 missense probably damaging 1.00
R0421:Kndc1 UTSW 7 139908996 missense probably damaging 1.00
R0487:Kndc1 UTSW 7 139914023 missense probably null 0.19
R0530:Kndc1 UTSW 7 139901237 missense probably damaging 1.00
R0905:Kndc1 UTSW 7 139923735 missense possibly damaging 0.94
R1434:Kndc1 UTSW 7 139922684 missense probably damaging 1.00
R1608:Kndc1 UTSW 7 139927408 missense possibly damaging 0.80
R1644:Kndc1 UTSW 7 139930756 missense probably damaging 1.00
R1835:Kndc1 UTSW 7 139927711 missense probably damaging 0.99
R2012:Kndc1 UTSW 7 139921280 missense possibly damaging 0.90
R2102:Kndc1 UTSW 7 139930761 missense probably benign 0.02
R2103:Kndc1 UTSW 7 139921234 missense probably benign 0.01
R2128:Kndc1 UTSW 7 139930112 missense probably damaging 1.00
R2516:Kndc1 UTSW 7 139921822 missense probably damaging 1.00
R3030:Kndc1 UTSW 7 139901207 missense probably damaging 1.00
R3617:Kndc1 UTSW 7 139902060 splice site probably benign
R3747:Kndc1 UTSW 7 139927904 critical splice donor site probably null
R3848:Kndc1 UTSW 7 139908977 missense probably damaging 1.00
R4028:Kndc1 UTSW 7 139930028 missense probably damaging 0.98
R4043:Kndc1 UTSW 7 139924129 missense probably benign 0.06
R4044:Kndc1 UTSW 7 139924129 missense probably benign 0.06
R4095:Kndc1 UTSW 7 139937025 missense possibly damaging 0.49
R4289:Kndc1 UTSW 7 139910882 missense probably benign 0.01
R4478:Kndc1 UTSW 7 139920684 missense probably damaging 1.00
R4514:Kndc1 UTSW 7 139910286 missense probably benign 0.00
R4540:Kndc1 UTSW 7 139921427 nonsense probably null
R4584:Kndc1 UTSW 7 139901243 missense probably damaging 1.00
R4693:Kndc1 UTSW 7 139921779 missense probably benign 0.02
R4705:Kndc1 UTSW 7 139930123 missense possibly damaging 0.81
R4773:Kndc1 UTSW 7 139924031 nonsense probably null
R4859:Kndc1 UTSW 7 139921905 missense probably benign 0.03
R5004:Kndc1 UTSW 7 139932879 nonsense probably null
R5037:Kndc1 UTSW 7 139910455 missense possibly damaging 0.52
R5322:Kndc1 UTSW 7 139936809 missense probably damaging 1.00
R5428:Kndc1 UTSW 7 139908962 missense probably damaging 0.99
R5503:Kndc1 UTSW 7 139931889 missense probably damaging 1.00
R5506:Kndc1 UTSW 7 139927891 missense probably damaging 1.00
R5525:Kndc1 UTSW 7 139924111 missense probably benign 0.00
R5888:Kndc1 UTSW 7 139895217 missense probably benign 0.00
R5942:Kndc1 UTSW 7 139936879 missense probably damaging 1.00
R5979:Kndc1 UTSW 7 139939827 missense probably benign 0.05
R5990:Kndc1 UTSW 7 139927420 missense probably damaging 0.99
R6038:Kndc1 UTSW 7 139923775 frame shift probably null
R6076:Kndc1 UTSW 7 139902038 missense probably damaging 1.00
R6118:Kndc1 UTSW 7 139923802 missense probably damaging 1.00
R6151:Kndc1 UTSW 7 139921213 missense probably benign 0.04
R6276:Kndc1 UTSW 7 139921063 missense probably benign
R6367:Kndc1 UTSW 7 139913506 missense probably damaging 1.00
R6726:Kndc1 UTSW 7 139922751 critical splice donor site probably null
R6745:Kndc1 UTSW 7 139920976 missense probably benign 0.02
R6886:Kndc1 UTSW 7 139913569 missense probably benign 0.01
R6912:Kndc1 UTSW 7 139910278 missense probably damaging 0.99
R7070:Kndc1 UTSW 7 139921828 missense probably damaging 1.00
R7123:Kndc1 UTSW 7 139936836 missense probably damaging 0.99
R7158:Kndc1 UTSW 7 139931860 missense possibly damaging 0.48
R7248:Kndc1 UTSW 7 139920783 missense probably damaging 1.00
R7437:Kndc1 UTSW 7 139909043 missense probably damaging 1.00
R7564:Kndc1 UTSW 7 139920696 missense probably benign 0.01
R7570:Kndc1 UTSW 7 139923775 frame shift probably null
R7625:Kndc1 UTSW 7 139938017 missense possibly damaging 0.90
R7629:Kndc1 UTSW 7 139895260 missense probably damaging 1.00
R7726:Kndc1 UTSW 7 139939838 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- TAGCTGAAGGGAGACGCTTG -3'
(R):5'- AAAGTGTGGATTCCCTGCAC -3'

Sequencing Primer
(F):5'- AAGGGAGACGCTTGGTTCTCAC -3'
(R):5'- GGATTCCCTGCACCCAGAGAAG -3'
Posted On2019-06-07