Incidental Mutation 'PIT4696001:Pde4a'
ID556798
Institutional Source Beutler Lab
Gene Symbol Pde4a
Ensembl Gene ENSMUSG00000032177
Gene Namephosphodiesterase 4A, cAMP specific
SynonymsDpde2, dunce, D9Ertd60e
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.285) question?
Stock #PIT4696001 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location21165714-21213248 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 21211001 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 731 (M731K)
Ref Sequence ENSEMBL: ENSMUSP00000037025 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003395] [ENSMUST00000039413] [ENSMUST00000115458]
Predicted Effect probably benign
Transcript: ENSMUST00000003395
AA Change: M497K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000003395
Gene: ENSMUSG00000032177
AA Change: M497K

DomainStartEndE-ValueType
low complexity region 62 87 N/A INTRINSIC
HDc 182 357 7.12e-5 SMART
low complexity region 462 475 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000039413
AA Change: M731K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000037025
Gene: ENSMUSG00000032177
AA Change: M731K

DomainStartEndE-ValueType
low complexity region 35 46 N/A INTRINSIC
low complexity region 92 102 N/A INTRINSIC
low complexity region 296 321 N/A INTRINSIC
HDc 416 591 7.12e-5 SMART
low complexity region 696 709 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115458
AA Change: M674K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000111118
Gene: ENSMUSG00000032177
AA Change: M674K

DomainStartEndE-ValueType
low complexity region 5 20 N/A INTRINSIC
low complexity region 239 264 N/A INTRINSIC
HDc 359 534 7.12e-5 SMART
low complexity region 639 652 N/A INTRINSIC
Coding Region Coverage
  • 1x: 93.5%
  • 3x: 91.0%
  • 10x: 86.2%
  • 20x: 75.9%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the cyclic nucleotide phosphodiesterase (PDE) family, and PDE4 subfamily. This PDE hydrolyzes the second messenger, cAMP, which is a regulator and mediator of a number of cellular responses to extracellular signals. Thus, by regulating the cellular concentration of cAMP, this protein plays a key role in many important physiological processes. Alternatively spliced transcript variants encoding different isoforms have been described for this gene.[provided by RefSeq, Jul 2011]
PHENOTYPE: Homozygous null mice have a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm3 G A 7: 119,784,986 probably null Het
Adam20 T A 8: 40,794,948 Y32N probably benign Het
Adm T C 7: 110,628,289 V4A probably benign Het
Anpep G A 7: 79,839,464 T320I possibly damaging Het
Atp8b1 T C 18: 64,539,270 S1008G possibly damaging Het
B9d1 T A 11: 61,505,243 M12K possibly damaging Het
Cad T C 5: 31,072,094 L1435P probably damaging Het
Cat T C 2: 103,471,812 D180G probably damaging Het
Cntln C T 4: 84,974,000 T374M probably damaging Het
Cyp2a5 G A 7: 26,840,979 R339Q probably benign Het
Defa22 T C 8: 21,162,336 L6P probably damaging Het
Dr1 T A 5: 108,269,738 I50K probably damaging Het
Eln C T 5: 134,737,178 G57E unknown Het
Fat4 T C 3: 38,889,004 I682T probably benign Het
Fat4 C A 3: 38,982,357 A3386E probably damaging Het
Fcgr3 T A 1: 171,057,750 Y102F probably damaging Het
Gm5930 A T 14: 44,336,536 L115M probably damaging Het
Herc1 T A 9: 66,479,009 V3748D probably damaging Het
Ino80d A G 1: 63,085,986 S106P probably benign Het
Kcns3 C T 12: 11,092,748 probably benign Het
Kndc1 T A 7: 139,932,917 L1527Q probably damaging Het
Lepr T G 4: 101,779,983 S690A probably benign Het
Lrfn5 T C 12: 61,843,557 F544S probably damaging Het
Mapkap1 C A 2: 34,619,849 H450Q probably damaging Het
Mdm1 A G 10: 118,158,540 T485A probably benign Het
Megf10 T C 18: 57,277,688 C690R probably damaging Het
Myo7a A G 7: 98,063,599 M1723T probably benign Het
Nrip3 A T 7: 109,765,507 C137* probably null Het
Olfr153 T A 2: 87,532,780 I249N probably damaging Het
Pebp1 A G 5: 117,283,462 L117P probably damaging Het
Phc2 T C 4: 128,705,202 Y51H probably damaging Het
Ppp2r5b A G 19: 6,234,683 F50S probably benign Het
Prpf4b A G 13: 34,899,842 S865G probably benign Het
Ptpn5 C T 7: 47,088,606 V243M probably benign Het
Rora T C 9: 69,364,559 L273P possibly damaging Het
Rtp4 T A 16: 23,613,454 S245R probably benign Het
Scgb2b20 C T 7: 33,364,560 G95D probably benign Het
Sec24b A G 3: 129,994,391 V820A probably benign Het
Sim2 A G 16: 94,094,309 D62G possibly damaging Het
Slc17a4 A T 13: 23,900,514 V429D probably benign Het
Sp2 T C 11: 96,961,973 T42A probably damaging Het
Spata3 G A 1: 86,024,447 R141Q unknown Het
Sptbn2 A T 19: 4,745,577 E1658D probably benign Het
Tcaf1 T C 6: 42,678,539 H501R probably benign Het
Tec G A 5: 72,773,835 T262M possibly damaging Het
Timm9 A T 12: 71,125,531 N22K possibly damaging Het
Tln1 C T 4: 43,542,701 probably null Het
Tmbim4 A G 10: 120,217,624 I109M probably benign Het
Tmc7 T C 7: 118,564,343 K110E probably benign Het
Tmem107 C T 11: 69,072,573 P136L probably benign Het
Ttc21b T C 2: 66,231,219 probably null Het
Ubd A C 17: 37,195,444 T74P probably damaging Het
Vps11 A G 9: 44,358,189 V255A possibly damaging Het
Vsnl1 T C 12: 11,326,447 T146A probably benign Het
Wdr38 G T 2: 38,999,972 probably null Het
Yes1 T A 5: 32,684,625 S498T possibly damaging Het
Zc3h13 G A 14: 75,331,883 R1390H probably damaging Het
Zscan4b A G 7: 10,902,022 V126A possibly damaging Het
Other mutations in Pde4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Pde4a APN 9 21211061 missense probably benign 0.01
IGL01330:Pde4a APN 9 21192438 splice site probably benign
IGL01403:Pde4a APN 9 21205116 missense probably damaging 1.00
IGL01610:Pde4a APN 9 21211350 utr 3 prime probably benign
IGL02010:Pde4a APN 9 21203554 critical splice donor site probably null
IGL02296:Pde4a APN 9 21192569 missense possibly damaging 0.94
IGL02637:Pde4a APN 9 21201332 missense probably damaging 0.97
R0032:Pde4a UTSW 9 21201432 splice site probably benign
R0032:Pde4a UTSW 9 21201432 splice site probably benign
R0257:Pde4a UTSW 9 21192421 missense probably damaging 1.00
R0504:Pde4a UTSW 9 21204403 missense probably damaging 1.00
R1437:Pde4a UTSW 9 21192592 critical splice donor site probably null
R1524:Pde4a UTSW 9 21201247 missense probably damaging 0.98
R1750:Pde4a UTSW 9 21203232 missense probably damaging 1.00
R2239:Pde4a UTSW 9 21211268 missense probably damaging 1.00
R2905:Pde4a UTSW 9 21201349 missense probably benign 0.01
R2991:Pde4a UTSW 9 21203243 missense probably damaging 0.96
R3972:Pde4a UTSW 9 21206217 missense probably damaging 1.00
R4826:Pde4a UTSW 9 21192380 splice site probably null
R4922:Pde4a UTSW 9 21210713 missense probably damaging 1.00
R5195:Pde4a UTSW 9 21204333 missense possibly damaging 0.70
R5208:Pde4a UTSW 9 21203558 splice site probably null
R5552:Pde4a UTSW 9 21201386 missense probably damaging 1.00
R5713:Pde4a UTSW 9 21203517 missense probably damaging 1.00
R6722:Pde4a UTSW 9 21211225 missense probably damaging 1.00
R6792:Pde4a UTSW 9 21192590 missense probably benign 0.03
R6861:Pde4a UTSW 9 21205301 missense probably damaging 1.00
R6901:Pde4a UTSW 9 21204970 missense probably benign 0.37
R7300:Pde4a UTSW 9 21206322 missense probably damaging 1.00
R7690:Pde4a UTSW 9 21166004 missense probably damaging 1.00
R7798:Pde4a UTSW 9 21198663 missense possibly damaging 0.63
X0027:Pde4a UTSW 9 21198654 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGGTATCACAGTGCCATCC -3'
(R):5'- ATTGTCTCCTGATGTCCCCGAG -3'

Sequencing Primer
(F):5'- TATCACAGTGCCATCCGCCAG -3'
(R):5'- TCATGGCAGCCAGATGGTCTC -3'
Posted On2019-06-07