Incidental Mutation 'R0605:Scrib'
ID 55680
Institutional Source Beutler Lab
Gene Symbol Scrib
Ensembl Gene ENSMUSG00000022568
Gene Name scribbled planar cell polarity
Synonyms Scrb1, Crc
MMRRC Submission 038794-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0605 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 75919011-75941633 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 75939402 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 94 (I94V)
Ref Sequence ENSEMBL: ENSMUSP00000105572 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002599] [ENSMUST00000002603] [ENSMUST00000063747] [ENSMUST00000100527] [ENSMUST00000109946] [ENSMUST00000227316] [ENSMUST00000230924]
AlphaFold Q80U72
Predicted Effect probably benign
Transcript: ENSMUST00000002599
SMART Domains Protein: ENSMUSP00000002599
Gene: ENSMUSG00000002524

DomainStartEndE-ValueType
low complexity region 21 34 N/A INTRINSIC
low complexity region 103 114 N/A INTRINSIC
RRM 118 191 1.21e-22 SMART
RRM 215 288 1.6e-22 SMART
low complexity region 290 338 N/A INTRINSIC
low complexity region 400 420 N/A INTRINSIC
RRM 451 533 7.68e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000002603
AA Change: I94V

PolyPhen 2 Score 0.891 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000002603
Gene: ENSMUSG00000022568
AA Change: I94V

DomainStartEndE-ValueType
LRR 58 80 1.99e0 SMART
LRR 81 104 2.54e2 SMART
LRR 127 149 3.56e2 SMART
LRR 150 172 2.33e1 SMART
LRR 173 195 2.45e0 SMART
LRR_TYP 196 218 7.78e-3 SMART
LRR 219 241 7.79e0 SMART
LRR 242 265 1.41e0 SMART
LRR 288 310 2.47e2 SMART
LRR_TYP 311 334 2.36e-2 SMART
LRR 335 356 7.8e1 SMART
LRR 357 380 1.22e2 SMART
low complexity region 455 466 N/A INTRINSIC
low complexity region 502 511 N/A INTRINSIC
coiled coil region 653 685 N/A INTRINSIC
PDZ 722 801 2e-23 SMART
low complexity region 822 837 N/A INTRINSIC
PDZ 856 936 1.23e-23 SMART
low complexity region 941 965 N/A INTRINSIC
low complexity region 968 978 N/A INTRINSIC
PDZ 998 1079 6.7e-25 SMART
PDZ 1095 1178 3.88e-21 SMART
low complexity region 1306 1321 N/A INTRINSIC
coiled coil region 1390 1420 N/A INTRINSIC
low complexity region 1452 1464 N/A INTRINSIC
low complexity region 1498 1515 N/A INTRINSIC
low complexity region 1549 1560 N/A INTRINSIC
low complexity region 1648 1665 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000063747
AA Change: I94V

PolyPhen 2 Score 0.891 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000068056
Gene: ENSMUSG00000022568
AA Change: I94V

DomainStartEndE-ValueType
LRR 58 80 1.99e0 SMART
LRR 81 104 2.54e2 SMART
LRR 127 149 3.56e2 SMART
LRR 150 172 2.33e1 SMART
LRR 173 195 2.45e0 SMART
LRR_TYP 196 218 7.78e-3 SMART
LRR 219 241 7.79e0 SMART
LRR 242 265 1.41e0 SMART
LRR 288 310 2.47e2 SMART
LRR_TYP 311 334 2.36e-2 SMART
LRR 335 356 7.8e1 SMART
LRR 357 380 1.22e2 SMART
low complexity region 455 466 N/A INTRINSIC
low complexity region 502 511 N/A INTRINSIC
coiled coil region 653 685 N/A INTRINSIC
PDZ 722 801 2e-23 SMART
low complexity region 822 837 N/A INTRINSIC
PDZ 856 936 1.23e-23 SMART
low complexity region 941 965 N/A INTRINSIC
low complexity region 968 978 N/A INTRINSIC
PDZ 998 1079 6.7e-25 SMART
PDZ 1095 1178 3.88e-21 SMART
low complexity region 1282 1293 N/A INTRINSIC
coiled coil region 1362 1392 N/A INTRINSIC
low complexity region 1424 1436 N/A INTRINSIC
low complexity region 1470 1487 N/A INTRINSIC
low complexity region 1521 1532 N/A INTRINSIC
low complexity region 1595 1612 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100527
SMART Domains Protein: ENSMUSP00000098096
Gene: ENSMUSG00000002524

DomainStartEndE-ValueType
low complexity region 21 34 N/A INTRINSIC
RRM 135 208 1.21e-22 SMART
RRM 232 305 1.6e-22 SMART
low complexity region 307 355 N/A INTRINSIC
low complexity region 417 437 N/A INTRINSIC
RRM 468 550 7.68e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000109946
AA Change: I94V

PolyPhen 2 Score 0.891 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000105572
Gene: ENSMUSG00000022568
AA Change: I94V

DomainStartEndE-ValueType
LRR 58 80 1.99e0 SMART
LRR 81 104 2.54e2 SMART
LRR 127 149 3.56e2 SMART
LRR 150 172 2.33e1 SMART
LRR 173 195 2.45e0 SMART
LRR_TYP 196 218 7.78e-3 SMART
LRR 219 241 7.79e0 SMART
LRR 242 265 1.41e0 SMART
LRR 288 310 2.47e2 SMART
LRR_TYP 311 334 2.36e-2 SMART
LRR 335 356 7.8e1 SMART
LRR 357 380 1.22e2 SMART
low complexity region 455 466 N/A INTRINSIC
low complexity region 502 511 N/A INTRINSIC
coiled coil region 653 685 N/A INTRINSIC
PDZ 722 801 2e-23 SMART
low complexity region 822 837 N/A INTRINSIC
PDZ 856 936 1.23e-23 SMART
low complexity region 941 965 N/A INTRINSIC
low complexity region 968 978 N/A INTRINSIC
PDZ 998 1079 6.7e-25 SMART
PDZ 1095 1178 3.88e-21 SMART
low complexity region 1282 1293 N/A INTRINSIC
coiled coil region 1362 1392 N/A INTRINSIC
low complexity region 1424 1436 N/A INTRINSIC
low complexity region 1470 1487 N/A INTRINSIC
low complexity region 1521 1532 N/A INTRINSIC
low complexity region 1620 1637 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136390
SMART Domains Protein: ENSMUSP00000119097
Gene: ENSMUSG00000022568

DomainStartEndE-ValueType
PDZ 27 106 2e-23 SMART
low complexity region 127 142 N/A INTRINSIC
PDZ 161 241 1.23e-23 SMART
low complexity region 246 270 N/A INTRINSIC
low complexity region 273 283 N/A INTRINSIC
PDZ 303 384 6.7e-25 SMART
PDZ 400 483 3.88e-21 SMART
low complexity region 611 626 N/A INTRINSIC
coiled coil region 694 724 N/A INTRINSIC
low complexity region 757 769 N/A INTRINSIC
low complexity region 803 820 N/A INTRINSIC
low complexity region 854 865 N/A INTRINSIC
low complexity region 928 945 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185092
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227251
Predicted Effect probably benign
Transcript: ENSMUST00000227316
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229474
Predicted Effect probably benign
Transcript: ENSMUST00000230924
Meta Mutation Damage Score 0.1306 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.4%
Validation Efficiency 100% (85/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that was identified as being similar to the Drosophila scribble protein. The mammalian protein is involved in tumor suppression pathways. As a scaffold protein involved in cell polarization processes, this protein binds to many other proteins. The encoded protein binds to papillomavirus E6 protein via its PDZ domain and the C-terminus of E6. Two alternatively spliced transcript variants that encode different protein isoforms have been found for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Mice homozygous for a null allele display partial prenatal lethality. Mice homozygous for spontaneous or induced alleles exhibit craniofacial or neural tube defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933406P04Rik G A 10: 20,186,973 (GRCm39) probably benign Het
Adam28 A T 14: 68,844,049 (GRCm39) probably benign Het
Adamts3 A G 5: 90,009,334 (GRCm39) W110R possibly damaging Het
Add1 T C 5: 34,771,568 (GRCm39) V342A possibly damaging Het
Aff3 A G 1: 38,249,068 (GRCm39) S680P probably damaging Het
Ak9 T C 10: 41,221,135 (GRCm39) Y322H probably damaging Het
Als2 A G 1: 59,207,573 (GRCm39) L1528S probably benign Het
Ass1 A T 2: 31,404,831 (GRCm39) N371Y probably damaging Het
Atp6v1a A C 16: 43,931,859 (GRCm39) probably null Het
Bpi T C 2: 158,103,314 (GRCm39) L103P probably damaging Het
Cd80 G A 16: 38,303,056 (GRCm39) V168I probably benign Het
Cfh T C 1: 140,030,096 (GRCm39) S926G probably damaging Het
Chrd A T 16: 20,554,189 (GRCm39) T304S probably damaging Het
Chsy3 A G 18: 59,542,125 (GRCm39) Y421C probably damaging Het
Cmbl T G 15: 31,585,455 (GRCm39) V101G probably damaging Het
Colgalt2 T A 1: 152,371,543 (GRCm39) probably benign Het
Coq4 C T 2: 29,680,010 (GRCm39) Q101* probably null Het
Cr2 T C 1: 194,845,904 (GRCm39) probably benign Het
Cry1 T C 10: 85,020,223 (GRCm39) D38G probably damaging Het
Dmxl2 T C 9: 54,327,229 (GRCm39) D758G probably benign Het
Epsti1 C T 14: 78,164,677 (GRCm39) probably benign Het
Fam24b T C 7: 130,928,915 (GRCm39) probably benign Het
Fem1c G A 18: 46,638,227 (GRCm39) R592C probably benign Het
Foxred1 T C 9: 35,116,178 (GRCm39) Y490C possibly damaging Het
Gm9875 A G 2: 13,562,699 (GRCm39) K9R unknown Het
Grid2ip T C 5: 143,365,117 (GRCm39) S322P probably damaging Het
Gucy1b2 A G 14: 62,640,608 (GRCm39) probably benign Het
Hmcn1 A T 1: 150,533,127 (GRCm39) probably null Het
Hpdl C T 4: 116,677,984 (GRCm39) S159N possibly damaging Het
Hsd17b12 A T 2: 93,863,987 (GRCm39) M285K probably benign Het
Icam5 T C 9: 20,943,493 (GRCm39) I23T probably benign Het
Kat5 A G 19: 5,658,364 (GRCm39) probably benign Het
Lama3 A G 18: 12,640,006 (GRCm39) N67S probably benign Het
Lamb2 T C 9: 108,363,304 (GRCm39) probably benign Het
Lgals3bp A G 11: 118,284,220 (GRCm39) F453S probably damaging Het
Lypd4 A G 7: 24,564,800 (GRCm39) Y113H probably damaging Het
Mdm1 C T 10: 117,982,506 (GRCm39) T47M probably damaging Het
Mei1 C A 15: 81,954,351 (GRCm39) T52K probably benign Het
Meiob G A 17: 25,037,236 (GRCm39) probably benign Het
Ndufaf6 A G 4: 11,051,224 (GRCm39) V292A probably damaging Het
Neb T A 2: 52,154,038 (GRCm39) M2358L possibly damaging Het
Nlrp1b A G 11: 71,047,005 (GRCm39) S1119P possibly damaging Het
Nsmaf A G 4: 6,418,470 (GRCm39) probably null Het
Ogfod1 T C 8: 94,773,895 (GRCm39) probably benign Het
Or5ae2 T C 7: 84,506,345 (GRCm39) I256T probably damaging Het
Or8h7 T C 2: 86,720,763 (GRCm39) Y252C possibly damaging Het
Or9s14 G T 1: 92,535,618 (GRCm39) V20L probably benign Het
Osbpl1a T A 18: 13,015,336 (GRCm39) probably null Het
Otud7b T A 3: 96,052,270 (GRCm39) probably benign Het
P3h3 T A 6: 124,832,998 (GRCm39) H185L probably damaging Het
P4htm G A 9: 108,460,923 (GRCm39) A183V probably null Het
Peak1 C T 9: 56,134,382 (GRCm39) probably benign Het
Phf20l1 A G 15: 66,466,971 (GRCm39) K88R probably damaging Het
Phlpp2 A G 8: 110,659,843 (GRCm39) N721S probably benign Het
Plagl2 T C 2: 153,077,864 (GRCm39) K39R probably benign Het
Plppr1 A T 4: 49,323,466 (GRCm39) N252I probably damaging Het
Pom121l2 C T 13: 22,166,206 (GRCm39) A159V probably damaging Het
Prom2 C A 2: 127,381,915 (GRCm39) probably null Het
Prrc2c T C 1: 162,509,995 (GRCm39) T1017A probably damaging Het
Rimbp3 G T 16: 17,029,563 (GRCm39) A996S probably damaging Het
Rnf213 A G 11: 119,322,543 (GRCm39) T1387A probably benign Het
Scaper A T 9: 55,722,802 (GRCm39) probably benign Het
Scara5 A G 14: 65,997,097 (GRCm39) E403G possibly damaging Het
Shank3 T C 15: 89,408,350 (GRCm39) F67L possibly damaging Het
Shprh T C 10: 11,082,856 (GRCm39) F1562L probably damaging Het
Src C T 2: 157,311,841 (GRCm39) T529M probably damaging Het
Sycp2l T A 13: 41,296,942 (GRCm39) M341K probably benign Het
Syde1 T C 10: 78,424,929 (GRCm39) probably benign Het
Tars3 A T 7: 65,327,819 (GRCm39) R509S probably damaging Het
Tle6 T A 10: 81,430,180 (GRCm39) H324L probably damaging Het
Tnfaip8 ACTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC ACTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC 18: 50,179,912 (GRCm39) probably benign Het
Tnfrsf14 T A 4: 155,009,837 (GRCm39) K115* probably null Het
Trappc10 T C 10: 78,037,331 (GRCm39) N824S possibly damaging Het
Tsc1 C T 2: 28,561,790 (GRCm39) S309F probably damaging Het
Ttc21a A G 9: 119,790,908 (GRCm39) I885V possibly damaging Het
Ttn C T 2: 76,570,797 (GRCm39) A26699T probably damaging Het
Ttn T C 2: 76,778,715 (GRCm39) Y1262C unknown Het
Usp49 T C 17: 47,985,851 (GRCm39) probably null Het
Vmn1r226 A T 17: 20,908,133 (GRCm39) T122S probably benign Het
Vps8 A T 16: 21,378,087 (GRCm39) T1033S probably benign Het
Vwf C A 6: 125,662,800 (GRCm39) T2728K probably benign Het
Wdr5b T C 16: 35,862,366 (GRCm39) S162P probably benign Het
Xrn1 C T 9: 95,908,930 (GRCm39) Q1235* probably null Het
Zfp1005 A G 2: 150,110,523 (GRCm39) I404M unknown Het
Other mutations in Scrib
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00886:Scrib APN 15 75,920,643 (GRCm39) missense possibly damaging 0.49
IGL00905:Scrib APN 15 75,936,839 (GRCm39) missense probably damaging 0.96
IGL01529:Scrib APN 15 75,921,084 (GRCm39) missense possibly damaging 0.66
IGL01896:Scrib APN 15 75,937,967 (GRCm39) missense possibly damaging 0.75
IGL01947:Scrib APN 15 75,933,616 (GRCm39) missense probably benign 0.01
IGL02219:Scrib APN 15 75,936,885 (GRCm39) nonsense probably null
IGL02372:Scrib APN 15 75,920,104 (GRCm39) missense probably damaging 0.99
IGL02880:Scrib APN 15 75,937,973 (GRCm39) missense probably damaging 1.00
IGL02959:Scrib APN 15 75,937,056 (GRCm39) missense probably damaging 0.99
R0711:Scrib UTSW 15 75,938,756 (GRCm39) unclassified probably benign
R0757:Scrib UTSW 15 75,934,599 (GRCm39) small deletion probably benign
R0903:Scrib UTSW 15 75,938,704 (GRCm39) missense possibly damaging 0.95
R0959:Scrib UTSW 15 75,923,310 (GRCm39) missense probably benign 0.34
R1483:Scrib UTSW 15 75,929,771 (GRCm39) missense probably damaging 1.00
R1551:Scrib UTSW 15 75,937,011 (GRCm39) missense probably damaging 1.00
R1604:Scrib UTSW 15 75,920,089 (GRCm39) missense probably damaging 0.97
R1613:Scrib UTSW 15 75,920,391 (GRCm39) missense probably damaging 1.00
R1615:Scrib UTSW 15 75,938,054 (GRCm39) missense probably benign 0.39
R1681:Scrib UTSW 15 75,936,416 (GRCm39) missense probably damaging 1.00
R3110:Scrib UTSW 15 75,941,223 (GRCm39) missense probably damaging 0.98
R3112:Scrib UTSW 15 75,941,223 (GRCm39) missense probably damaging 0.98
R4050:Scrib UTSW 15 75,923,322 (GRCm39) missense possibly damaging 0.91
R4660:Scrib UTSW 15 75,937,185 (GRCm39) missense probably damaging 0.98
R4976:Scrib UTSW 15 75,923,602 (GRCm39) critical splice donor site probably null
R5119:Scrib UTSW 15 75,923,602 (GRCm39) critical splice donor site probably null
R5243:Scrib UTSW 15 75,937,101 (GRCm39) missense probably benign 0.00
R5246:Scrib UTSW 15 75,936,646 (GRCm39) missense probably benign 0.19
R5483:Scrib UTSW 15 75,939,508 (GRCm39) critical splice donor site probably null
R5516:Scrib UTSW 15 75,934,712 (GRCm39) missense possibly damaging 0.50
R5628:Scrib UTSW 15 75,921,389 (GRCm39) missense possibly damaging 0.66
R5787:Scrib UTSW 15 75,931,151 (GRCm39) missense probably damaging 1.00
R5894:Scrib UTSW 15 75,939,581 (GRCm39) missense probably damaging 0.99
R6005:Scrib UTSW 15 75,929,600 (GRCm39) missense probably damaging 1.00
R6041:Scrib UTSW 15 75,939,021 (GRCm39) missense possibly damaging 0.93
R6351:Scrib UTSW 15 75,936,835 (GRCm39) missense possibly damaging 0.65
R6603:Scrib UTSW 15 75,934,572 (GRCm39) missense probably benign 0.00
R7298:Scrib UTSW 15 75,936,610 (GRCm39) missense probably damaging 1.00
R7344:Scrib UTSW 15 75,921,107 (GRCm39) missense probably damaging 1.00
R7428:Scrib UTSW 15 75,933,047 (GRCm39) missense probably damaging 1.00
R7486:Scrib UTSW 15 75,929,499 (GRCm39) missense probably damaging 1.00
R7764:Scrib UTSW 15 75,919,242 (GRCm39) makesense probably null
R7994:Scrib UTSW 15 75,936,431 (GRCm39) missense probably damaging 1.00
R8084:Scrib UTSW 15 75,937,940 (GRCm39) missense probably benign 0.07
R8096:Scrib UTSW 15 75,934,558 (GRCm39) missense probably benign
R8157:Scrib UTSW 15 75,931,037 (GRCm39) missense possibly damaging 0.52
R8217:Scrib UTSW 15 75,939,004 (GRCm39) missense probably damaging 0.99
R8693:Scrib UTSW 15 75,936,354 (GRCm39) missense probably damaging 0.98
R8731:Scrib UTSW 15 75,935,488 (GRCm39) missense probably benign
R8922:Scrib UTSW 15 75,933,587 (GRCm39) critical splice donor site probably null
R9163:Scrib UTSW 15 75,921,108 (GRCm39) missense probably damaging 1.00
R9457:Scrib UTSW 15 75,939,148 (GRCm39) missense probably damaging 1.00
R9646:Scrib UTSW 15 75,932,492 (GRCm39) missense probably damaging 1.00
Z1088:Scrib UTSW 15 75,920,080 (GRCm39) missense probably damaging 0.99
Z1177:Scrib UTSW 15 75,929,619 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCATCAAGGGGCACTCACTTGC -3'
(R):5'- AAGTTGGGCCTCAGTGACAACG -3'

Sequencing Primer
(F):5'- TAGCTGTGTGAAGCCATCC -3'
(R):5'- TCAGTGACAACGAGATCCAG -3'
Posted On 2013-07-11