Mutagenetix > Incidental Mutation

Incidental Mutation 'PIT4696001:Sptbn2'

556820

Institutional Source

Beutler Lab

Gene Symbol

Sptbn2

Ensembl Gene

ENSMUSG00000067889

Gene Name

spectrin beta, non-erythrocytic 2

Synonyms

Spnb3

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

PIT4696001 (G1)

Quality Score

222.009

Status

Validated

Chromosome

Chromosomal Location

4711208-4752353 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 4745577 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Aspartic acid at position 1658 (E1658D)

Ref Sequence

ENSEMBL: ENSMUSP00000008991 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000008991] [ENSMUST00000178353]

AlphaFold

Q68FG2

Predicted Effect

probably benign
Transcript: ENSMUST00000008991
AA Change: E1658D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000008991
Gene: ENSMUSG00000067889
AA Change: E1658D

Domain	Start	End	E-Value	Type
CH	59	159	1.86e-28	SMART
CH	178	276	2.86e-20	SMART
SPEC	308	414	4.63e-1	SMART
SPEC	428	528	3.07e-23	SMART
SPEC	534	638	4.47e-25	SMART
SPEC	644	744	1.28e-25	SMART
SPEC	750	849	4.98e-23	SMART
SPEC	855	955	1.63e-18	SMART
SPEC	961	1062	1.45e-24	SMART
SPEC	1068	1169	4.15e-20	SMART
SPEC	1175	1275	5.26e-22	SMART
SPEC	1281	1380	1.17e-19	SMART
SPEC	1386	1485	2.06e-24	SMART
SPEC	1491	1585	1.74e-22	SMART
SPEC	1591	1691	5.42e-24	SMART
SPEC	1697	1798	2.1e-21	SMART
SPEC	1804	1904	5.47e-20	SMART
SPEC	1910	2010	1.99e-22	SMART
SPEC	2016	2256	2.92e-6	SMART
PH	2219	2330	1.65e-14	SMART
low complexity region	2373	2386	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000178353

SMART Domains

Protein: ENSMUSP00000136599
Gene: ENSMUSG00000096370

Domain	Start	End	E-Value	Type
RRM	2	69	1.96e-17	SMART
Pfam:RRM_1	81	118	5.6e-7	PFAM

Coding Region Coverage

1x: 93.5%
3x: 91.0%
10x: 86.2%
20x: 75.9%

Validation Efficiency

100% (57/57)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Spectrins are principle components of a cell's membrane-cytoskeleton and are composed of two alpha and two beta spectrin subunits. The protein encoded by this gene (SPTBN2), is called spectrin beta non-erythrocytic 2 or beta-III spectrin. It is related to, but distinct from, the beta-II spectrin gene which is also known as spectrin beta non-erythrocytic 1 (SPTBN1). SPTBN2 regulates the glutamate signaling pathway by stabilizing the glutamate transporter EAAT4 at the surface of the plasma membrane. Mutations in this gene cause a form of spinocerebellar ataxia, SCA5, that is characterized by neurodegeneration, progressive locomotor incoordination, dysarthria, and uncoordinated eye movements. [provided by RefSeq, Dec 2009]
PHENOTYPE: Homozygous hypomorphic mutants exhibit a progressive ataxic phenotype with gait abnormalities, tremor, deteriorating motor coordination, Purkinje cell loss, and cerebellar atrophy (molecular layer thinning) and age-related reduction in simple firing ratein surviving Purkinje cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acsm3	G	A	7: 119,784,986		probably null	Het
Adam20	T	A	8: 40,794,948	Y32N	probably benign	Het
Adm	T	C	7: 110,628,289	V4A	probably benign	Het
Anpep	G	A	7: 79,839,464	T320I	possibly damaging	Het
Atp8b1	T	C	18: 64,539,270	S1008G	possibly damaging	Het
B9d1	T	A	11: 61,505,243	M12K	possibly damaging	Het
Cad	T	C	5: 31,072,094	L1435P	probably damaging	Het
Cat	T	C	2: 103,471,812	D180G	probably damaging	Het
Cntln	C	T	4: 84,974,000	T374M	probably damaging	Het
Cyp2a5	G	A	7: 26,840,979	R339Q	probably benign	Het
Defa22	T	C	8: 21,162,336	L6P	probably damaging	Het
Dr1	T	A	5: 108,269,738	I50K	probably damaging	Het
Eln	C	T	5: 134,737,178	G57E	unknown	Het
Fat4	T	C	3: 38,889,004	I682T	probably benign	Het
Fat4	C	A	3: 38,982,357	A3386E	probably damaging	Het
Fcgr3	T	A	1: 171,057,750	Y102F	probably damaging	Het
Gm5930	A	T	14: 44,336,536	L115M	probably damaging	Het
Herc1	T	A	9: 66,479,009	V3748D	probably damaging	Het
Ino80d	A	G	1: 63,085,986	S106P	probably benign	Het
Kcns3	C	T	12: 11,092,748		probably benign	Het
Kndc1	T	A	7: 139,932,917	L1527Q	probably damaging	Het
Lepr	T	G	4: 101,779,983	S690A	probably benign	Het
Lrfn5	T	C	12: 61,843,557	F544S	probably damaging	Het
Mapkap1	C	A	2: 34,619,849	H450Q	probably damaging	Het
Mdm1	A	G	10: 118,158,540	T485A	probably benign	Het
Megf10	T	C	18: 57,277,688	C690R	probably damaging	Het
Myo7a	A	G	7: 98,063,599	M1723T	probably benign	Het
Nrip3	A	T	7: 109,765,507	C137*	probably null	Het
Olfr153	T	A	2: 87,532,780	I249N	probably damaging	Het
Pde4a	T	A	9: 21,211,001	M731K	probably benign	Het
Pebp1	A	G	5: 117,283,462	L117P	probably damaging	Het
Phc2	T	C	4: 128,705,202	Y51H	probably damaging	Het
Ppp2r5b	A	G	19: 6,234,683	F50S	probably benign	Het
Prpf4b	A	G	13: 34,899,842	S865G	probably benign	Het
Ptpn5	C	T	7: 47,088,606	V243M	probably benign	Het
Rora	T	C	9: 69,364,559	L273P	possibly damaging	Het
Rtp4	T	A	16: 23,613,454	S245R	probably benign	Het
Scgb2b20	C	T	7: 33,364,560	G95D	probably benign	Het
Sec24b	A	G	3: 129,994,391	V820A	probably benign	Het
Sim2	A	G	16: 94,094,309	D62G	possibly damaging	Het
Slc17a4	A	T	13: 23,900,514	V429D	probably benign	Het
Sp2	T	C	11: 96,961,973	T42A	probably damaging	Het
Spata3	G	A	1: 86,024,447	R141Q	unknown	Het
Tcaf1	T	C	6: 42,678,539	H501R	probably benign	Het
Tec	G	A	5: 72,773,835	T262M	possibly damaging	Het
Timm9	A	T	12: 71,125,531	N22K	possibly damaging	Het
Tln1	C	T	4: 43,542,701		probably null	Het
Tmbim4	A	G	10: 120,217,624	I109M	probably benign	Het
Tmc7	T	C	7: 118,564,343	K110E	probably benign	Het
Tmem107	C	T	11: 69,072,573	P136L	probably benign	Het
Ttc21b	T	C	2: 66,231,219		probably null	Het
Ubd	A	C	17: 37,195,444	T74P	probably damaging	Het
Vps11	A	G	9: 44,358,189	V255A	possibly damaging	Het
Vsnl1	T	C	12: 11,326,447	T146A	probably benign	Het
Wdr38	G	T	2: 38,999,972		probably null	Het
Yes1	T	A	5: 32,684,625	S498T	possibly damaging	Het
Zc3h13	G	A	14: 75,331,883	R1390H	probably damaging	Het
Zscan4b	A	G	7: 10,902,022	V126A	possibly damaging	Het

Other mutations in Sptbn2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00421:Sptbn2	APN	19	4724705	missense	possibly damaging	0.94
IGL00688:Sptbn2	APN	19	4725938	missense	probably damaging	1.00
IGL01339:Sptbn2	APN	19	4745972	nonsense	probably null
IGL01373:Sptbn2	APN	19	4745972	nonsense	probably null
IGL01420:Sptbn2	APN	19	4734125	missense	probably benign
IGL01456:Sptbn2	APN	19	4746749	missense	probably damaging	1.00
IGL01953:Sptbn2	APN	19	4749693	missense	probably benign
IGL03026:Sptbn2	APN	19	4724233	critical splice donor site	probably null
IGL03275:Sptbn2	APN	19	4732661	missense	possibly damaging	0.65
IGL03286:Sptbn2	APN	19	4747832	missense	probably damaging	0.97
F5770:Sptbn2	UTSW	19	4750632	missense	probably damaging	1.00
R0046:Sptbn2	UTSW	19	4745377	intron	probably benign
R0046:Sptbn2	UTSW	19	4745377	intron	probably benign
R0121:Sptbn2	UTSW	19	4745293	missense	probably damaging	1.00
R0127:Sptbn2	UTSW	19	4724744	missense	probably damaging	1.00
R0212:Sptbn2	UTSW	19	4746942	critical splice donor site	probably null
R0277:Sptbn2	UTSW	19	4745145	missense	probably benign	0.28
R0417:Sptbn2	UTSW	19	4737926	missense	probably benign	0.01
R0457:Sptbn2	UTSW	19	4745938	missense	possibly damaging	0.89
R0536:Sptbn2	UTSW	19	4726690	missense	probably damaging	0.99
R0631:Sptbn2	UTSW	19	4739986	missense	probably benign	0.01
R0734:Sptbn2	UTSW	19	4748123	nonsense	probably null
R0742:Sptbn2	UTSW	19	4718983	missense	possibly damaging	0.46
R1195:Sptbn2	UTSW	19	4745893	missense	possibly damaging	0.85
R1195:Sptbn2	UTSW	19	4745893	missense	possibly damaging	0.85
R1195:Sptbn2	UTSW	19	4745893	missense	possibly damaging	0.85
R1364:Sptbn2	UTSW	19	4732665	missense	probably damaging	1.00
R1495:Sptbn2	UTSW	19	4718976	missense	possibly damaging	0.92
R1498:Sptbn2	UTSW	19	4744246	missense	possibly damaging	0.94
R1606:Sptbn2	UTSW	19	4750242	critical splice donor site	probably null
R1678:Sptbn2	UTSW	19	4750497	missense	probably damaging	1.00
R1746:Sptbn2	UTSW	19	4745964	nonsense	probably null
R1820:Sptbn2	UTSW	19	4726596	missense	probably damaging	0.98
R1830:Sptbn2	UTSW	19	4732541	missense	probably benign	0.09
R1863:Sptbn2	UTSW	19	4732685	missense	possibly damaging	0.54
R1967:Sptbn2	UTSW	19	4745299	missense	probably benign	0.00
R2085:Sptbn2	UTSW	19	4738559	missense	probably benign	0.09
R2301:Sptbn2	UTSW	19	4734138	missense	probably benign	0.00
R2310:Sptbn2	UTSW	19	4718935	missense	probably benign	0.19
R2888:Sptbn2	UTSW	19	4748636	missense	possibly damaging	0.52
R3788:Sptbn2	UTSW	19	4745922	missense	probably damaging	1.00
R4429:Sptbn2	UTSW	19	4738355	missense	probably damaging	1.00
R4536:Sptbn2	UTSW	19	4732602	missense	probably damaging	1.00
R4662:Sptbn2	UTSW	19	4739239	missense	probably damaging	1.00
R4672:Sptbn2	UTSW	19	4732496	missense	probably benign	0.25
R4731:Sptbn2	UTSW	19	4742480	missense	probably damaging	0.96
R4747:Sptbn2	UTSW	19	4748154	missense	probably benign	0.27
R4889:Sptbn2	UTSW	19	4729430	missense	possibly damaging	0.69
R4891:Sptbn2	UTSW	19	4738469	missense	probably damaging	1.00
R4965:Sptbn2	UTSW	19	4729309	missense	probably benign	0.13
R4968:Sptbn2	UTSW	19	4729202	splice site	probably null
R4981:Sptbn2	UTSW	19	4751658	missense	probably benign	0.22
R5159:Sptbn2	UTSW	19	4737857	missense	probably benign	0.12
R5202:Sptbn2	UTSW	19	4724184	missense	probably damaging	1.00
R5253:Sptbn2	UTSW	19	4750082	missense	probably benign	0.01
R5294:Sptbn2	UTSW	19	4718908	missense	possibly damaging	0.67
R5465:Sptbn2	UTSW	19	4750105	missense	probably benign	0.00
R5546:Sptbn2	UTSW	19	4725950	missense	probably damaging	1.00
R5593:Sptbn2	UTSW	19	4748947	missense	probably damaging	1.00
R5780:Sptbn2	UTSW	19	4724667	missense	probably damaging	1.00
R5835:Sptbn2	UTSW	19	4738219	missense	probably damaging	1.00
R6008:Sptbn2	UTSW	19	4739278	missense	possibly damaging	0.89
R6108:Sptbn2	UTSW	19	4731392	critical splice donor site	probably null
R6236:Sptbn2	UTSW	19	4748138	missense	probably benign	0.01
R6307:Sptbn2	UTSW	19	4724646	missense	probably damaging	1.00
R6383:Sptbn2	UTSW	19	4732496	missense	possibly damaging	0.89
R6397:Sptbn2	UTSW	19	4742418	missense	possibly damaging	0.91
R6453:Sptbn2	UTSW	19	4744180	missense	possibly damaging	0.67
R6561:Sptbn2	UTSW	19	4747926	missense	probably benign	0.39
R6564:Sptbn2	UTSW	19	4732024	missense	probably damaging	1.00
R6644:Sptbn2	UTSW	19	4749012	missense	probably benign	0.05
R6703:Sptbn2	UTSW	19	4749814	missense	probably benign
R6703:Sptbn2	UTSW	19	4749815	missense	probably benign
R6753:Sptbn2	UTSW	19	4747785	missense	probably benign	0.01
R7007:Sptbn2	UTSW	19	4744145	missense	possibly damaging	0.82
R7131:Sptbn2	UTSW	19	4749460	missense	probably null
R7219:Sptbn2	UTSW	19	4724173	missense	probably damaging	1.00
R7285:Sptbn2	UTSW	19	4737443	missense	probably benign	0.00
R7308:Sptbn2	UTSW	19	4751574	missense	probably benign
R7469:Sptbn2	UTSW	19	4745118	missense	probably benign	0.00
R7502:Sptbn2	UTSW	19	4748082	missense	probably benign	0.02
R7623:Sptbn2	UTSW	19	4726168	missense	probably damaging	1.00
R7635:Sptbn2	UTSW	19	4744207	missense	probably damaging	1.00
R7733:Sptbn2	UTSW	19	4749012	missense	probably benign	0.05
R7738:Sptbn2	UTSW	19	4724125	missense	probably damaging	1.00
R7742:Sptbn2	UTSW	19	4749012	missense	probably benign	0.05
R7767:Sptbn2	UTSW	19	4734143	missense	possibly damaging	0.62
R7795:Sptbn2	UTSW	19	4749012	missense	probably benign	0.05
R7796:Sptbn2	UTSW	19	4749012	missense	probably benign	0.05
R7871:Sptbn2	UTSW	19	4749012	missense	probably benign	0.05
R7877:Sptbn2	UTSW	19	4744262	missense	possibly damaging	0.93
R7920:Sptbn2	UTSW	19	4749012	missense	probably benign	0.05
R7921:Sptbn2	UTSW	19	4749012	missense	probably benign	0.05
R7923:Sptbn2	UTSW	19	4746799	missense	probably benign	0.01
R8137:Sptbn2	UTSW	19	4737403	missense	possibly damaging	0.81
R8305:Sptbn2	UTSW	19	4729130	missense	possibly damaging	0.81
R8695:Sptbn2	UTSW	19	4746696	missense	possibly damaging	0.86
R8790:Sptbn2	UTSW	19	4732024	missense	probably damaging	1.00
R9125:Sptbn2	UTSW	19	4734213	missense	probably benign	0.04
R9483:Sptbn2	UTSW	19	4739946	missense	probably damaging	1.00
R9620:Sptbn2	UTSW	19	4750507	missense	probably damaging	0.99
R9631:Sptbn2	UTSW	19	4738190	missense	probably damaging	1.00
R9646:Sptbn2	UTSW	19	4745313	missense	probably damaging	1.00
R9694:Sptbn2	UTSW	19	4750507	missense	probably damaging	0.99
V7580:Sptbn2	UTSW	19	4750632	missense	probably damaging	1.00
Z1176:Sptbn2	UTSW	19	4738205	missense	probably damaging	1.00
Z1176:Sptbn2	UTSW	19	4745191	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- GTTACACATGATGGGCCAGG -3'
(R):5'- GCTCTGTGTCACCTAACTGC -3'

Sequencing Primer
(F):5'- GTGCGGCCAGTTCTTCTAC -3'
(R):5'- AACTGCTCTGTCTGCTAACTG -3'

Posted On

2019-06-07