Incidental Mutation 'PIT4810001:Aplnr'
ID556830
Institutional Source Beutler Lab
Gene Symbol Aplnr
Ensembl Gene ENSMUSG00000044338
Gene Nameapelin receptor
Synonymsapelin receptor, APJ, Agtrl1, msr/apj
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #PIT4810001 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location85136225-85139923 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 85137284 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 218 (C218S)
Ref Sequence ENSEMBL: ENSMUSP00000053638 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057019] [ENSMUST00000184728]
Predicted Effect probably damaging
Transcript: ENSMUST00000057019
AA Change: C218S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000053638
Gene: ENSMUSG00000044338
AA Change: C218S

DomainStartEndE-ValueType
Pfam:TAS2R 25 326 1.1e-8 PFAM
Pfam:7tm_1 43 307 4e-61 PFAM
Pfam:7TM_GPCR_Srv 46 324 3.5e-8 PFAM
low complexity region 335 349 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184728
SMART Domains Protein: ENSMUSP00000139142
Gene: ENSMUSG00000044338

DomainStartEndE-ValueType
SCOP:d1l9ha_ 1 47 7e-3 SMART
Coding Region Coverage
  • 1x: 93.8%
  • 3x: 91.1%
  • 10x: 85.1%
  • 20x: 72.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the G protein-coupled receptor gene family. The encoded protein is related to the angiotensin receptor, but is actually an apelin receptor that inhibits adenylate cyclase activity and plays a counter-regulatory role against the pressure action of angiotensin II by exerting hypertensive effect. It functions in the cardiovascular and central nervous systems, in glucose metabolism, in embryonic and tumor angiogenesis and as a human immunodeficiency virus (HIV-1) coreceptor. Two transcript variants resulting from alternative splicing have been identified. [provided by RefSeq, Jul 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit early lethality, decreased cardiac contractility, and decreased exercise endurance. Mice for another knock-out allele develop pulmonary venoocclusive disease with heart right ventricle hypertrophy and elevated pulmonary pressures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810046K07Rik C T 9: 51,291,692 G54D possibly damaging Het
4932438H23Rik A G 16: 91,055,934 S105P probably damaging Het
Adtrp C T 13: 41,828,248 W48* probably null Het
Agxt2 A T 15: 10,399,065 M413L probably benign Het
Ahnak2 T A 12: 112,785,594 D211V Het
Arhgdib T A 6: 136,924,164 E189V probably damaging Het
Atp10a T C 7: 58,813,848 I1043T probably damaging Het
Atp13a5 C T 16: 29,314,564 C468Y probably damaging Het
Cars2 A T 8: 11,514,699 C459S probably benign Het
Ccr3 T A 9: 124,029,608 Y327N probably benign Het
Ceacam1 T A 7: 25,471,975 I355F probably damaging Het
Celsr3 T C 9: 108,845,733 L2773P probably damaging Het
Ces2g A T 8: 104,964,889 H192L possibly damaging Het
Cfap157 A G 2: 32,781,432 F121L probably damaging Het
Champ1 G A 8: 13,879,234 S464N probably benign Het
Clasp2 T A 9: 113,906,067 L990Q probably damaging Het
Col6a3 A T 1: 90,778,794 L2806Q unknown Het
Cpz T C 5: 35,508,192 E435G possibly damaging Het
Crbn T A 6: 106,784,479 R233* probably null Het
Ctc1 C T 11: 69,022,526 T116I probably benign Het
Cyp4f17 T C 17: 32,524,600 S314P possibly damaging Het
Dmxl1 A G 18: 49,931,963 E2625G probably damaging Het
Dock7 T A 4: 98,945,559 R1874* probably null Het
E130311K13Rik A T 3: 63,915,701 L174* probably null Het
Etnppl A G 3: 130,620,714 D86G probably benign Het
Fbxw18 C A 9: 109,676,890 E438* probably null Het
Gpatch8 T C 11: 102,481,842 N290S unknown Het
Gpr155 A C 2: 73,348,263 L727R probably benign Het
Gpr158 C G 2: 21,826,871 D927E probably benign Het
Igsf10 T C 3: 59,318,482 Y2590C probably damaging Het
Ints7 A G 1: 191,596,236 D207G probably damaging Het
Iqsec1 A G 6: 90,670,491 L743P probably damaging Het
Kansl1l A T 1: 66,762,149 S553T probably damaging Het
Klhl14 G T 18: 21,557,823 Y523* probably null Het
Krtap14 A G 16: 88,825,627 S155P probably damaging Het
Lrrc3b A G 14: 15,358,273 V111A probably benign Het
Maml2 A G 9: 13,620,024 N178S Het
Megf8 G A 7: 25,342,285 C1208Y probably damaging Het
Mocos A G 18: 24,686,702 D667G probably damaging Het
Nid2 A G 14: 19,810,090 T1359A possibly damaging Het
Nup210 T C 6: 91,030,124 E1357G probably damaging Het
Olfr1239 A T 2: 89,417,953 H153Q probably damaging Het
Olfr1411 T A 1: 92,597,154 F212I probably benign Het
Olfr715 A T 7: 107,128,559 M278K probably benign Het
Pign A G 1: 105,597,762 V447A possibly damaging Het
Pomp T C 5: 147,869,419 L57P probably benign Het
Rbms3 T A 9: 117,056,793 Y128F probably damaging Het
Slc12a4 A G 8: 105,951,596 F322L probably benign Het
Slc16a9 T A 10: 70,283,932 C468* probably null Het
Slc22a18 A G 7: 143,492,931 I271V probably benign Het
Slc25a41 A G 17: 57,039,933 V20A possibly damaging Het
Smim7 A T 8: 72,571,013 L6Q probably damaging Het
Snx29 T C 16: 11,400,981 V227A probably damaging Het
Sowaha A T 11: 53,478,463 L482Q probably damaging Het
Srp19 A G 18: 34,334,470 Y68C probably damaging Het
Tecr A G 8: 83,572,255 S298P probably damaging Het
Terb2 T A 2: 122,204,898 I200N probably damaging Het
Togaram1 G A 12: 64,983,512 S1030N probably damaging Het
Trav7n-4 A G 14: 53,091,736 M68V probably benign Het
Tshz1 A C 18: 84,013,250 L1011R possibly damaging Het
Tubb3 A G 8: 123,421,657 E443G possibly damaging Het
Uba5 A T 9: 104,055,197 I189K probably damaging Het
Vasn A G 16: 4,650,045 T619A probably benign Het
Wbp1l A G 19: 46,654,322 D254G probably benign Het
Zzef1 T C 11: 72,850,745 F738L probably damaging Het
Other mutations in Aplnr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Aplnr APN 2 85137641 missense probably benign 0.00
IGL00985:Aplnr APN 2 85137663 missense probably benign 0.02
R0009:Aplnr UTSW 2 85137276 unclassified probably null
R0009:Aplnr UTSW 2 85137276 unclassified probably null
R0201:Aplnr UTSW 2 85137177 missense probably damaging 1.00
R1268:Aplnr UTSW 2 85137431 missense possibly damaging 0.80
R1386:Aplnr UTSW 2 85137461 missense possibly damaging 0.71
R1445:Aplnr UTSW 2 85137009 missense probably damaging 1.00
R1663:Aplnr UTSW 2 85136694 missense possibly damaging 0.53
R1967:Aplnr UTSW 2 85137606 missense probably benign
R4119:Aplnr UTSW 2 85136966 missense possibly damaging 0.96
R4672:Aplnr UTSW 2 85137180 missense probably damaging 1.00
R4916:Aplnr UTSW 2 85136917 missense probably damaging 1.00
R4968:Aplnr UTSW 2 85136945 missense probably damaging 1.00
R4990:Aplnr UTSW 2 85137377 missense probably damaging 0.96
R5067:Aplnr UTSW 2 85136784 missense probably damaging 1.00
R6235:Aplnr UTSW 2 85137626 missense probably benign
R6433:Aplnr UTSW 2 85136673 missense probably benign
R6828:Aplnr UTSW 2 85139759 utr 3 prime probably benign
R6898:Aplnr UTSW 2 85139811 utr 3 prime probably benign
R7547:Aplnr UTSW 2 85137177 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGCAGTCTTATGGGTGCTG -3'
(R):5'- TCAAAGTCACAGGGCCAGTG -3'

Sequencing Primer
(F):5'- GGCTGCCCTTCTAGCTGTG -3'
(R):5'- CAGGGCCAGTGCAGCAAAC -3'
Posted On2019-06-07