Incidental Mutation 'PIT4810001:Crbn'
ID556841
Institutional Source Beutler Lab
Gene Symbol Crbn
Ensembl Gene ENSMUSG00000005362
Gene Namecereblon
Synonyms
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.553) question?
Stock #PIT4810001 (G1)
Quality Score162.009
Status Not validated
Chromosome6
Chromosomal Location106780201-106800077 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 106784479 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 233 (R233*)
Ref Sequence ENSEMBL: ENSMUSP00000108865 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013882] [ENSMUST00000057578] [ENSMUST00000113239] [ENSMUST00000113248] [ENSMUST00000113249] [ENSMUST00000151484]
Predicted Effect probably null
Transcript: ENSMUST00000013882
AA Change: R232*
SMART Domains Protein: ENSMUSP00000013882
Gene: ENSMUSG00000005362
AA Change: R232*

DomainStartEndE-ValueType
low complexity region 23 39 N/A INTRINSIC
LON 82 319 2.33e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000057578
SMART Domains Protein: ENSMUSP00000060900
Gene: ENSMUSG00000013736

DomainStartEndE-ValueType
Pfam:PolyA_pol 59 182 3.8e-36 PFAM
Pfam:PolyA_pol_RNAbd 215 271 1.4e-14 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000113239
AA Change: R233*
SMART Domains Protein: ENSMUSP00000108865
Gene: ENSMUSG00000005362
AA Change: R233*

DomainStartEndE-ValueType
low complexity region 24 40 N/A INTRINSIC
LON 83 320 2.33e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113248
SMART Domains Protein: ENSMUSP00000108874
Gene: ENSMUSG00000013736

DomainStartEndE-ValueType
Pfam:PolyA_pol 59 182 2.4e-37 PFAM
Pfam:PolyA_pol_RNAbd 215 272 9.3e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113249
SMART Domains Protein: ENSMUSP00000108875
Gene: ENSMUSG00000013736

DomainStartEndE-ValueType
Pfam:PolyA_pol 59 182 3.8e-36 PFAM
Pfam:PolyA_pol_RNAbd 215 271 1.4e-14 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000151484
AA Change: R220*
SMART Domains Protein: ENSMUSP00000144723
Gene: ENSMUSG00000005362
AA Change: R220*

DomainStartEndE-ValueType
low complexity region 11 27 N/A INTRINSIC
LON 70 253 3.1e-9 SMART
Coding Region Coverage
  • 1x: 93.8%
  • 3x: 91.1%
  • 10x: 85.1%
  • 20x: 72.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein with a Lon protease domain, a "regulators of G protein-signaling" (RGS)-like domain and a leucine zipper. It has been proposed to regulate the assembly and surface expression of large-conductance calcium-activated potassium channels in brain and to bind thalidomide. In humans mutation in this gene causes autosomal recessive nonsyndromic mental retardation. In mouse deficiency of this gene serves as a model to study the molecular mechanisms governing learning and memory as they relate to intellectual disability. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired contextual conditioning behavior. Mice homozygous for another knock-out allele exhibit resistance to diet-induced obesity, liver steatosis, glucose intolerance and insulin resistance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810046K07Rik C T 9: 51,291,692 G54D possibly damaging Het
4932438H23Rik A G 16: 91,055,934 S105P probably damaging Het
Adtrp C T 13: 41,828,248 W48* probably null Het
Agxt2 A T 15: 10,399,065 M413L probably benign Het
Ahnak2 T A 12: 112,785,594 D211V Het
Aplnr T A 2: 85,137,284 C218S probably damaging Het
Arhgdib T A 6: 136,924,164 E189V probably damaging Het
Atp10a T C 7: 58,813,848 I1043T probably damaging Het
Atp13a5 C T 16: 29,314,564 C468Y probably damaging Het
Cars2 A T 8: 11,514,699 C459S probably benign Het
Ccr3 T A 9: 124,029,608 Y327N probably benign Het
Ceacam1 T A 7: 25,471,975 I355F probably damaging Het
Celsr3 T C 9: 108,845,733 L2773P probably damaging Het
Ces2g A T 8: 104,964,889 H192L possibly damaging Het
Cfap157 A G 2: 32,781,432 F121L probably damaging Het
Champ1 G A 8: 13,879,234 S464N probably benign Het
Clasp2 T A 9: 113,906,067 L990Q probably damaging Het
Col6a3 A T 1: 90,778,794 L2806Q unknown Het
Cpz T C 5: 35,508,192 E435G possibly damaging Het
Ctc1 C T 11: 69,022,526 T116I probably benign Het
Cyp4f17 T C 17: 32,524,600 S314P possibly damaging Het
Dmxl1 A G 18: 49,931,963 E2625G probably damaging Het
Dock7 T A 4: 98,945,559 R1874* probably null Het
E130311K13Rik A T 3: 63,915,701 L174* probably null Het
Etnppl A G 3: 130,620,714 D86G probably benign Het
Fbxw18 C A 9: 109,676,890 E438* probably null Het
Gpatch8 T C 11: 102,481,842 N290S unknown Het
Gpr155 A C 2: 73,348,263 L727R probably benign Het
Gpr158 C G 2: 21,826,871 D927E probably benign Het
Igsf10 T C 3: 59,318,482 Y2590C probably damaging Het
Ints7 A G 1: 191,596,236 D207G probably damaging Het
Iqsec1 A G 6: 90,670,491 L743P probably damaging Het
Kansl1l A T 1: 66,762,149 S553T probably damaging Het
Klhl14 G T 18: 21,557,823 Y523* probably null Het
Krtap14 A G 16: 88,825,627 S155P probably damaging Het
Lrrc3b A G 14: 15,358,273 V111A probably benign Het
Maml2 A G 9: 13,620,024 N178S Het
Megf8 G A 7: 25,342,285 C1208Y probably damaging Het
Mocos A G 18: 24,686,702 D667G probably damaging Het
Nid2 A G 14: 19,810,090 T1359A possibly damaging Het
Nup210 T C 6: 91,030,124 E1357G probably damaging Het
Olfr1239 A T 2: 89,417,953 H153Q probably damaging Het
Olfr1411 T A 1: 92,597,154 F212I probably benign Het
Olfr715 A T 7: 107,128,559 M278K probably benign Het
Pign A G 1: 105,597,762 V447A possibly damaging Het
Pomp T C 5: 147,869,419 L57P probably benign Het
Rbms3 T A 9: 117,056,793 Y128F probably damaging Het
Slc12a4 A G 8: 105,951,596 F322L probably benign Het
Slc16a9 T A 10: 70,283,932 C468* probably null Het
Slc22a18 A G 7: 143,492,931 I271V probably benign Het
Slc25a41 A G 17: 57,039,933 V20A possibly damaging Het
Smim7 A T 8: 72,571,013 L6Q probably damaging Het
Snx29 T C 16: 11,400,981 V227A probably damaging Het
Sowaha A T 11: 53,478,463 L482Q probably damaging Het
Srp19 A G 18: 34,334,470 Y68C probably damaging Het
Tecr A G 8: 83,572,255 S298P probably damaging Het
Terb2 T A 2: 122,204,898 I200N probably damaging Het
Togaram1 G A 12: 64,983,512 S1030N probably damaging Het
Trav7n-4 A G 14: 53,091,736 M68V probably benign Het
Tshz1 A C 18: 84,013,250 L1011R possibly damaging Het
Tubb3 A G 8: 123,421,657 E443G possibly damaging Het
Uba5 A T 9: 104,055,197 I189K probably damaging Het
Vasn A G 16: 4,650,045 T619A probably benign Het
Wbp1l A G 19: 46,654,322 D254G probably benign Het
Zzef1 T C 11: 72,850,745 F738L probably damaging Het
Other mutations in Crbn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02268:Crbn APN 6 106795043 missense possibly damaging 0.78
R0457:Crbn UTSW 6 106781057 missense probably benign 0.06
R1468:Crbn UTSW 6 106790843 missense probably benign 0.07
R1468:Crbn UTSW 6 106790843 missense probably benign 0.07
R1672:Crbn UTSW 6 106795925 missense probably damaging 1.00
R1710:Crbn UTSW 6 106790945 missense possibly damaging 0.90
R2255:Crbn UTSW 6 106795198 critical splice acceptor site probably null
R2427:Crbn UTSW 6 106783472 missense probably damaging 1.00
R3160:Crbn UTSW 6 106790866 missense probably benign 0.00
R3162:Crbn UTSW 6 106790866 missense probably benign 0.00
R3765:Crbn UTSW 6 106795026 missense possibly damaging 0.64
R3766:Crbn UTSW 6 106795026 missense possibly damaging 0.64
R4674:Crbn UTSW 6 106790971 missense possibly damaging 0.95
R4703:Crbn UTSW 6 106782922 missense possibly damaging 0.66
R5089:Crbn UTSW 6 106781718 missense possibly damaging 0.76
R5436:Crbn UTSW 6 106795900 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGCGTTAATGATGCAGAGATAAGC -3'
(R):5'- CATTGCAGATAATCACCTTCCGTG -3'

Sequencing Primer
(F):5'- GCAGAGATAAGCAACAATATACTTGC -3'
(R):5'- CACCTTCCGTGAGATGTGAATAC -3'
Posted On2019-06-07