Incidental Mutation 'R0605:Vps8'
ID55685
Institutional Source Beutler Lab
Gene Symbol Vps8
Ensembl Gene ENSMUSG00000033653
Gene NameVPS8 CORVET complex subunit
Synonyms
MMRRC Submission 038794-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0605 (G1)
Quality Score209
Status Validated
Chromosome16
Chromosomal Location21423118-21644680 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 21559337 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 1033 (T1033S)
Ref Sequence ENSEMBL: ENSMUSP00000112636 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096191] [ENSMUST00000096192] [ENSMUST00000115397] [ENSMUST00000117598] [ENSMUST00000118138] [ENSMUST00000118923] [ENSMUST00000156580]
Predicted Effect probably benign
Transcript: ENSMUST00000096191
AA Change: T1061S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000093905
Gene: ENSMUSG00000033653
AA Change: T1061S

DomainStartEndE-ValueType
low complexity region 96 112 N/A INTRINSIC
SCOP:d1g72a_ 158 296 1e-8 SMART
Blast:WD40 184 225 7e-22 BLAST
Blast:WD40 228 268 5e-20 BLAST
Pfam:Vps8 610 794 1.7e-61 PFAM
low complexity region 992 1007 N/A INTRINSIC
low complexity region 1085 1097 N/A INTRINSIC
low complexity region 1126 1137 N/A INTRINSIC
Blast:RING 1257 1277 1e-5 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000096192
AA Change: T1033S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000093906
Gene: ENSMUSG00000033653
AA Change: T1033S

DomainStartEndE-ValueType
low complexity region 96 112 N/A INTRINSIC
SCOP:d1g72a_ 158 298 1e-8 SMART
Blast:WD40 186 227 8e-22 BLAST
Blast:WD40 230 270 5e-20 BLAST
Pfam:Vps8 612 796 1.4e-61 PFAM
low complexity region 969 979 N/A INTRINSIC
low complexity region 1057 1069 N/A INTRINSIC
low complexity region 1098 1109 N/A INTRINSIC
RING 1229 1280 1.23e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115397
AA Change: T1063S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000111055
Gene: ENSMUSG00000033653
AA Change: T1063S

DomainStartEndE-ValueType
low complexity region 96 112 N/A INTRINSIC
SCOP:d1g72a_ 158 298 8e-9 SMART
Blast:WD40 186 227 8e-22 BLAST
Blast:WD40 230 270 5e-20 BLAST
Pfam:Vps8 613 796 1.3e-61 PFAM
low complexity region 994 1009 N/A INTRINSIC
low complexity region 1087 1099 N/A INTRINSIC
low complexity region 1128 1139 N/A INTRINSIC
RING 1259 1310 1.23e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117598
AA Change: T1061S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000112937
Gene: ENSMUSG00000033653
AA Change: T1061S

DomainStartEndE-ValueType
low complexity region 96 112 N/A INTRINSIC
SCOP:d1g72a_ 158 296 1e-8 SMART
Blast:WD40 184 225 8e-22 BLAST
Blast:WD40 228 268 5e-20 BLAST
Pfam:Vps8 610 794 1.9e-61 PFAM
low complexity region 992 1007 N/A INTRINSIC
low complexity region 1085 1097 N/A INTRINSIC
low complexity region 1126 1137 N/A INTRINSIC
RING 1257 1308 1.23e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000118138
SMART Domains Protein: ENSMUSP00000113447
Gene: ENSMUSG00000033653

DomainStartEndE-ValueType
Pfam:Vps8 1 76 7.7e-21 PFAM
low complexity region 274 289 N/A INTRINSIC
low complexity region 367 379 N/A INTRINSIC
low complexity region 408 419 N/A INTRINSIC
RING 539 590 1.23e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000118923
AA Change: T1033S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000112636
Gene: ENSMUSG00000033653
AA Change: T1033S

DomainStartEndE-ValueType
low complexity region 96 112 N/A INTRINSIC
SCOP:d1g72a_ 158 298 9e-9 SMART
Blast:WD40 186 227 8e-22 BLAST
Blast:WD40 230 270 5e-20 BLAST
Pfam:Vps8 612 796 1.9e-61 PFAM
low complexity region 969 979 N/A INTRINSIC
low complexity region 1057 1069 N/A INTRINSIC
low complexity region 1098 1109 N/A INTRINSIC
RING 1229 1280 1.23e-4 SMART
Predicted Effect unknown
Transcript: ENSMUST00000125487
AA Change: T631S
SMART Domains Protein: ENSMUSP00000114719
Gene: ENSMUSG00000033653
AA Change: T631S

DomainStartEndE-ValueType
Pfam:Vps8 182 365 8.5e-62 PFAM
low complexity region 563 578 N/A INTRINSIC
low complexity region 656 668 N/A INTRINSIC
low complexity region 697 708 N/A INTRINSIC
RING 828 879 1.23e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000156580
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231484
Predicted Effect probably benign
Transcript: ENSMUST00000232357
Meta Mutation Damage Score 0.1213 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.4%
Validation Efficiency 100% (85/85)
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933406P04Rik G A 10: 20,311,227 probably benign Het
Adam28 A T 14: 68,606,600 probably benign Het
Adamts3 A G 5: 89,861,475 W110R possibly damaging Het
Add1 T C 5: 34,614,224 V342A possibly damaging Het
Aff3 A G 1: 38,209,987 S680P probably damaging Het
Ak9 T C 10: 41,345,139 Y322H probably damaging Het
Als2 A G 1: 59,168,414 L1528S probably benign Het
Ass1 A T 2: 31,514,819 N371Y probably damaging Het
Atp6v1a A C 16: 44,111,496 probably null Het
Bpi T C 2: 158,261,394 L103P probably damaging Het
Cd80 G A 16: 38,482,694 V168I probably benign Het
Cfh T C 1: 140,102,358 S926G probably damaging Het
Chrd A T 16: 20,735,439 T304S probably damaging Het
Chsy3 A G 18: 59,409,053 Y421C probably damaging Het
Cmbl T G 15: 31,585,309 V101G probably damaging Het
Colgalt2 T A 1: 152,495,792 probably benign Het
Coq4 C T 2: 29,789,998 Q101* probably null Het
Cr2 T C 1: 195,163,596 probably benign Het
Cry1 T C 10: 85,184,359 D38G probably damaging Het
Dmxl2 T C 9: 54,419,945 D758G probably benign Het
Epsti1 C T 14: 77,927,237 probably benign Het
Fam24b T C 7: 131,327,186 probably benign Het
Fem1c G A 18: 46,505,160 R592C probably benign Het
Foxred1 T C 9: 35,204,882 Y490C possibly damaging Het
Gm14124 A G 2: 150,268,603 I404M unknown Het
Gm9875 A G 2: 13,557,888 K9R unknown Het
Grid2ip T C 5: 143,379,362 S322P probably damaging Het
Gucy1b2 A G 14: 62,403,159 probably benign Het
Hmcn1 A T 1: 150,657,376 probably null Het
Hpdl C T 4: 116,820,787 S159N possibly damaging Het
Hsd17b12 A T 2: 94,033,642 M285K probably benign Het
Icam5 T C 9: 21,032,197 I23T probably benign Het
Kat5 A G 19: 5,608,336 probably benign Het
Lama3 A G 18: 12,506,949 N67S probably benign Het
Lamb2 T C 9: 108,486,105 probably benign Het
Lgals3bp A G 11: 118,393,394 F453S probably damaging Het
Lypd4 A G 7: 24,865,375 Y113H probably damaging Het
Mdm1 C T 10: 118,146,601 T47M probably damaging Het
Mei1 C A 15: 82,070,150 T52K probably benign Het
Meiob G A 17: 24,818,262 probably benign Het
Ndufaf6 A G 4: 11,051,224 V292A probably damaging Het
Neb T A 2: 52,264,026 M2358L possibly damaging Het
Nlrp1b A G 11: 71,156,179 S1119P possibly damaging Het
Nsmaf A G 4: 6,418,470 probably null Het
Ogfod1 T C 8: 94,047,267 probably benign Het
Olfr1097 T C 2: 86,890,419 Y252C possibly damaging Het
Olfr1410 G T 1: 92,607,896 V20L probably benign Het
Olfr291 T C 7: 84,857,137 I256T probably damaging Het
Osbpl1a T A 18: 12,882,279 probably null Het
Otud7b T A 3: 96,144,959 probably benign Het
P3h3 T A 6: 124,856,035 H185L probably damaging Het
P4htm G A 9: 108,583,724 A183V probably null Het
Peak1 C T 9: 56,227,098 probably benign Het
Phf20l1 A G 15: 66,595,122 K88R probably damaging Het
Phlpp2 A G 8: 109,933,211 N721S probably benign Het
Plagl2 T C 2: 153,235,944 K39R probably benign Het
Plppr1 A T 4: 49,323,466 N252I probably damaging Het
Pom121l2 C T 13: 21,982,036 A159V probably damaging Het
Prom2 C A 2: 127,539,995 probably null Het
Prrc2c T C 1: 162,682,426 T1017A probably damaging Het
Rimbp3 G T 16: 17,211,699 A996S probably damaging Het
Rnf213 A G 11: 119,431,717 T1387A probably benign Het
Scaper A T 9: 55,815,518 probably benign Het
Scara5 A G 14: 65,759,648 E403G possibly damaging Het
Scrib T C 15: 76,067,553 I94V possibly damaging Het
Shank3 T C 15: 89,524,147 F67L possibly damaging Het
Shprh T C 10: 11,207,112 F1562L probably damaging Het
Src C T 2: 157,469,921 T529M probably damaging Het
Sycp2l T A 13: 41,143,466 M341K probably benign Het
Syde1 T C 10: 78,589,095 probably benign Het
Tarsl2 A T 7: 65,678,071 R509S probably damaging Het
Tle6 T A 10: 81,594,346 H324L probably damaging Het
Tnfaip8 ACTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC ACTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC 18: 50,046,845 probably benign Het
Tnfrsf14 T A 4: 154,925,380 K115* probably null Het
Trappc10 T C 10: 78,201,497 N824S possibly damaging Het
Tsc1 C T 2: 28,671,778 S309F probably damaging Het
Ttc21a A G 9: 119,961,842 I885V possibly damaging Het
Ttn C T 2: 76,740,453 A26699T probably damaging Het
Ttn T C 2: 76,948,371 Y1262C unknown Het
Usp49 T C 17: 47,674,926 probably null Het
Vmn1r226 A T 17: 20,687,871 T122S probably benign Het
Vwf C A 6: 125,685,837 T2728K probably benign Het
Wdr5b T C 16: 36,041,996 S162P probably benign Het
Xrn1 C T 9: 96,026,877 Q1235* probably null Het
Other mutations in Vps8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00500:Vps8 APN 16 21442334 missense possibly damaging 0.47
IGL00596:Vps8 APN 16 21448412 splice site probably benign
IGL00985:Vps8 APN 16 21477584 splice site probably benign
IGL01356:Vps8 APN 16 21517357 critical splice donor site probably null
IGL01375:Vps8 APN 16 21559372 nonsense probably null
IGL01643:Vps8 APN 16 21518222 missense possibly damaging 0.92
IGL02159:Vps8 APN 16 21466484 missense possibly damaging 0.69
IGL02214:Vps8 APN 16 21517285 missense probably damaging 1.00
IGL02465:Vps8 APN 16 21521903 missense probably damaging 1.00
IGL02651:Vps8 APN 16 21517336 missense probably damaging 0.99
IGL03174:Vps8 APN 16 21466463 missense probably damaging 1.00
IGL03337:Vps8 APN 16 21563168 missense probably benign
IGL03383:Vps8 APN 16 21435823 critical splice donor site probably null
IGL03402:Vps8 APN 16 21448398 missense possibly damaging 0.68
empires UTSW 16 21581548 nonsense probably null
porky UTSW 16 21461238 missense probably benign 0.32
realm UTSW 16 21545236 intron probably benign
realms UTSW 16 21444188 unclassified probably null
Reich UTSW 16 21478439 missense probably benign 0.29
reichen UTSW 16 21506825 splice site probably benign
IGL03052:Vps8 UTSW 16 21448365 missense probably damaging 0.99
PIT4677001:Vps8 UTSW 16 21500334 missense possibly damaging 0.94
R0066:Vps8 UTSW 16 21477523 missense possibly damaging 0.77
R0066:Vps8 UTSW 16 21477523 missense possibly damaging 0.77
R0125:Vps8 UTSW 16 21470154 missense probably benign 0.00
R0137:Vps8 UTSW 16 21504386 splice site probably benign
R0362:Vps8 UTSW 16 21608227 intron probably benign
R0384:Vps8 UTSW 16 21506825 splice site probably benign
R0492:Vps8 UTSW 16 21442357 missense probably damaging 1.00
R0525:Vps8 UTSW 16 21540109 critical splice donor site probably null
R0531:Vps8 UTSW 16 21459811 intron probably benign
R0636:Vps8 UTSW 16 21434933 missense probably benign 0.32
R0707:Vps8 UTSW 16 21442357 missense probably damaging 1.00
R0840:Vps8 UTSW 16 21456321 missense probably damaging 0.99
R1170:Vps8 UTSW 16 21459820 intron probably benign
R1203:Vps8 UTSW 16 21511557 missense probably damaging 1.00
R1482:Vps8 UTSW 16 21581598 missense probably benign 0.00
R1531:Vps8 UTSW 16 21466476 nonsense probably null
R1642:Vps8 UTSW 16 21581579 missense probably benign
R1956:Vps8 UTSW 16 21461142 missense probably damaging 1.00
R2201:Vps8 UTSW 16 21576757 missense probably damaging 1.00
R2287:Vps8 UTSW 16 21568413 missense probably damaging 1.00
R2423:Vps8 UTSW 16 21559337 missense probably benign 0.00
R3151:Vps8 UTSW 16 21442373 missense probably benign 0.04
R3943:Vps8 UTSW 16 21470123 missense probably damaging 1.00
R3944:Vps8 UTSW 16 21470123 missense probably damaging 1.00
R4043:Vps8 UTSW 16 21526396 missense probably damaging 1.00
R4302:Vps8 UTSW 16 21495914 missense probably damaging 1.00
R4398:Vps8 UTSW 16 21504466 missense probably damaging 1.00
R4477:Vps8 UTSW 16 21545236 intron probably benign
R4478:Vps8 UTSW 16 21545236 intron probably benign
R4479:Vps8 UTSW 16 21545236 intron probably benign
R4480:Vps8 UTSW 16 21545236 intron probably benign
R4571:Vps8 UTSW 16 21435775 missense probably damaging 1.00
R4653:Vps8 UTSW 16 21500210 missense probably damaging 1.00
R4664:Vps8 UTSW 16 21444188 unclassified probably null
R4713:Vps8 UTSW 16 21442439 missense probably damaging 1.00
R4726:Vps8 UTSW 16 21448404 unclassified probably null
R4959:Vps8 UTSW 16 21459786 missense probably damaging 1.00
R4973:Vps8 UTSW 16 21459786 missense probably damaging 1.00
R4975:Vps8 UTSW 16 21466469 missense probably damaging 1.00
R4992:Vps8 UTSW 16 21461408 missense possibly damaging 0.52
R5144:Vps8 UTSW 16 21559353 missense probably damaging 1.00
R5168:Vps8 UTSW 16 21457445 missense probably damaging 0.99
R5168:Vps8 UTSW 16 21533099 missense probably benign 0.05
R5222:Vps8 UTSW 16 21581548 nonsense probably null
R5231:Vps8 UTSW 16 21576725 missense probably damaging 1.00
R5876:Vps8 UTSW 16 21461439 critical splice donor site probably null
R5963:Vps8 UTSW 16 21470121 missense possibly damaging 0.48
R6010:Vps8 UTSW 16 21545205 intron probably benign
R6023:Vps8 UTSW 16 21461238 missense probably benign 0.32
R6173:Vps8 UTSW 16 21495932 splice site probably null
R6185:Vps8 UTSW 16 21470141 missense probably damaging 0.98
R6264:Vps8 UTSW 16 21559349 nonsense probably null
R6409:Vps8 UTSW 16 21478439 missense probably benign 0.29
R6522:Vps8 UTSW 16 21442379 missense probably damaging 0.99
R6528:Vps8 UTSW 16 21554125 nonsense probably null
R6784:Vps8 UTSW 16 21563207 missense probably benign 0.01
R7040:Vps8 UTSW 16 21575022 missense probably damaging 1.00
R7072:Vps8 UTSW 16 21581579 missense probably benign
R7103:Vps8 UTSW 16 21526441 missense probably damaging 1.00
R7149:Vps8 UTSW 16 21459776 missense probably damaging 1.00
R7195:Vps8 UTSW 16 21456282 missense probably damaging 1.00
R7206:Vps8 UTSW 16 21457421 missense probably damaging 1.00
R7403:Vps8 UTSW 16 21434972 missense possibly damaging 0.78
R7782:Vps8 UTSW 16 21511558 missense possibly damaging 0.89
R7806:Vps8 UTSW 16 21459751 missense probably damaging 1.00
R7846:Vps8 UTSW 16 21532320 missense probably benign 0.01
R8075:Vps8 UTSW 16 21521894 missense probably damaging 0.99
R8190:Vps8 UTSW 16 21575030 missense possibly damaging 0.73
R8307:Vps8 UTSW 16 21495902 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GCCAGATAAGTTCGCCCTAAGACAG -3'
(R):5'- ACAAGGCACGCACAGCCTTATG -3'

Sequencing Primer
(F):5'- CCTAAGACAGGCTGCACAGAG -3'
(R):5'- AAATATGGAGCCGTTCTCAGTG -3'
Posted On2013-07-11