Incidental Mutation 'R0605:Wdr5b'
ID 55686
Institutional Source Beutler Lab
Gene Symbol Wdr5b
Ensembl Gene ENSMUSG00000034379
Gene Name WD repeat domain 5B
Synonyms 2310009C03Rik
MMRRC Submission 038794-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.143) question?
Stock # R0605 (G1)
Quality Score 225
Status Validated
Chromosome 16
Chromosomal Location 35861560-35863344 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 35862366 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 162 (S162P)
Ref Sequence ENSEMBL: ENSMUSP00000040852 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004054] [ENSMUST00000004057] [ENSMUST00000042203] [ENSMUST00000231351]
AlphaFold Q9D7H2
Predicted Effect probably benign
Transcript: ENSMUST00000004054
SMART Domains Protein: ENSMUSP00000004054
Gene: ENSMUSG00000022905

DomainStartEndE-ValueType
Pfam:IBB 6 104 1.3e-27 PFAM
ARM 115 156 1.47e-2 SMART
ARM 158 198 2.51e-10 SMART
ARM 200 241 7.16e-6 SMART
ARM 244 283 2.22e1 SMART
ARM 285 325 1.45e-6 SMART
ARM 327 367 1.12e-7 SMART
ARM 369 409 1.76e-5 SMART
ARM 412 452 2.91e-6 SMART
Pfam:Arm_3 466 516 6e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000004057
SMART Domains Protein: ENSMUSP00000004057
Gene: ENSMUSG00000003955

DomainStartEndE-ValueType
Pfam:DUF1075 10 155 1.8e-69 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000042203
AA Change: S162P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000040852
Gene: ENSMUSG00000034379
AA Change: S162P

DomainStartEndE-ValueType
WD40 28 67 5.95e-7 SMART
WD40 70 109 1.28e-11 SMART
WD40 112 151 4.87e-12 SMART
WD40 154 193 5.22e-12 SMART
WD40 196 236 1.21e-7 SMART
WD40 239 281 5.47e-6 SMART
WD40 284 325 1.01e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000231351
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231379
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232390
Meta Mutation Damage Score 0.0674 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.4%
Validation Efficiency 100% (85/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This intronless gene encodes a protein containing several WD40 repeats. WD repeats are approximately 30- to 40-amino acid domains containing several conserved residues, including a trp-asp at the C-terminal end. The encoded protein may mediate protein-protein interactions. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933406P04Rik G A 10: 20,186,973 (GRCm39) probably benign Het
Adam28 A T 14: 68,844,049 (GRCm39) probably benign Het
Adamts3 A G 5: 90,009,334 (GRCm39) W110R possibly damaging Het
Add1 T C 5: 34,771,568 (GRCm39) V342A possibly damaging Het
Aff3 A G 1: 38,249,068 (GRCm39) S680P probably damaging Het
Ak9 T C 10: 41,221,135 (GRCm39) Y322H probably damaging Het
Als2 A G 1: 59,207,573 (GRCm39) L1528S probably benign Het
Ass1 A T 2: 31,404,831 (GRCm39) N371Y probably damaging Het
Atp6v1a A C 16: 43,931,859 (GRCm39) probably null Het
Bpi T C 2: 158,103,314 (GRCm39) L103P probably damaging Het
Cd80 G A 16: 38,303,056 (GRCm39) V168I probably benign Het
Cfh T C 1: 140,030,096 (GRCm39) S926G probably damaging Het
Chrd A T 16: 20,554,189 (GRCm39) T304S probably damaging Het
Chsy3 A G 18: 59,542,125 (GRCm39) Y421C probably damaging Het
Cmbl T G 15: 31,585,455 (GRCm39) V101G probably damaging Het
Colgalt2 T A 1: 152,371,543 (GRCm39) probably benign Het
Coq4 C T 2: 29,680,010 (GRCm39) Q101* probably null Het
Cr2 T C 1: 194,845,904 (GRCm39) probably benign Het
Cry1 T C 10: 85,020,223 (GRCm39) D38G probably damaging Het
Dmxl2 T C 9: 54,327,229 (GRCm39) D758G probably benign Het
Epsti1 C T 14: 78,164,677 (GRCm39) probably benign Het
Fam24b T C 7: 130,928,915 (GRCm39) probably benign Het
Fem1c G A 18: 46,638,227 (GRCm39) R592C probably benign Het
Foxred1 T C 9: 35,116,178 (GRCm39) Y490C possibly damaging Het
Gm9875 A G 2: 13,562,699 (GRCm39) K9R unknown Het
Grid2ip T C 5: 143,365,117 (GRCm39) S322P probably damaging Het
Gucy1b2 A G 14: 62,640,608 (GRCm39) probably benign Het
Hmcn1 A T 1: 150,533,127 (GRCm39) probably null Het
Hpdl C T 4: 116,677,984 (GRCm39) S159N possibly damaging Het
Hsd17b12 A T 2: 93,863,987 (GRCm39) M285K probably benign Het
Icam5 T C 9: 20,943,493 (GRCm39) I23T probably benign Het
Kat5 A G 19: 5,658,364 (GRCm39) probably benign Het
Lama3 A G 18: 12,640,006 (GRCm39) N67S probably benign Het
Lamb2 T C 9: 108,363,304 (GRCm39) probably benign Het
Lgals3bp A G 11: 118,284,220 (GRCm39) F453S probably damaging Het
Lypd4 A G 7: 24,564,800 (GRCm39) Y113H probably damaging Het
Mdm1 C T 10: 117,982,506 (GRCm39) T47M probably damaging Het
Mei1 C A 15: 81,954,351 (GRCm39) T52K probably benign Het
Meiob G A 17: 25,037,236 (GRCm39) probably benign Het
Ndufaf6 A G 4: 11,051,224 (GRCm39) V292A probably damaging Het
Neb T A 2: 52,154,038 (GRCm39) M2358L possibly damaging Het
Nlrp1b A G 11: 71,047,005 (GRCm39) S1119P possibly damaging Het
Nsmaf A G 4: 6,418,470 (GRCm39) probably null Het
Ogfod1 T C 8: 94,773,895 (GRCm39) probably benign Het
Or5ae2 T C 7: 84,506,345 (GRCm39) I256T probably damaging Het
Or8h7 T C 2: 86,720,763 (GRCm39) Y252C possibly damaging Het
Or9s14 G T 1: 92,535,618 (GRCm39) V20L probably benign Het
Osbpl1a T A 18: 13,015,336 (GRCm39) probably null Het
Otud7b T A 3: 96,052,270 (GRCm39) probably benign Het
P3h3 T A 6: 124,832,998 (GRCm39) H185L probably damaging Het
P4htm G A 9: 108,460,923 (GRCm39) A183V probably null Het
Peak1 C T 9: 56,134,382 (GRCm39) probably benign Het
Phf20l1 A G 15: 66,466,971 (GRCm39) K88R probably damaging Het
Phlpp2 A G 8: 110,659,843 (GRCm39) N721S probably benign Het
Plagl2 T C 2: 153,077,864 (GRCm39) K39R probably benign Het
Plppr1 A T 4: 49,323,466 (GRCm39) N252I probably damaging Het
Pom121l2 C T 13: 22,166,206 (GRCm39) A159V probably damaging Het
Prom2 C A 2: 127,381,915 (GRCm39) probably null Het
Prrc2c T C 1: 162,509,995 (GRCm39) T1017A probably damaging Het
Rimbp3 G T 16: 17,029,563 (GRCm39) A996S probably damaging Het
Rnf213 A G 11: 119,322,543 (GRCm39) T1387A probably benign Het
Scaper A T 9: 55,722,802 (GRCm39) probably benign Het
Scara5 A G 14: 65,997,097 (GRCm39) E403G possibly damaging Het
Scrib T C 15: 75,939,402 (GRCm39) I94V possibly damaging Het
Shank3 T C 15: 89,408,350 (GRCm39) F67L possibly damaging Het
Shprh T C 10: 11,082,856 (GRCm39) F1562L probably damaging Het
Src C T 2: 157,311,841 (GRCm39) T529M probably damaging Het
Sycp2l T A 13: 41,296,942 (GRCm39) M341K probably benign Het
Syde1 T C 10: 78,424,929 (GRCm39) probably benign Het
Tars3 A T 7: 65,327,819 (GRCm39) R509S probably damaging Het
Tle6 T A 10: 81,430,180 (GRCm39) H324L probably damaging Het
Tnfaip8 ACTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC ACTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC 18: 50,179,912 (GRCm39) probably benign Het
Tnfrsf14 T A 4: 155,009,837 (GRCm39) K115* probably null Het
Trappc10 T C 10: 78,037,331 (GRCm39) N824S possibly damaging Het
Tsc1 C T 2: 28,561,790 (GRCm39) S309F probably damaging Het
Ttc21a A G 9: 119,790,908 (GRCm39) I885V possibly damaging Het
Ttn C T 2: 76,570,797 (GRCm39) A26699T probably damaging Het
Ttn T C 2: 76,778,715 (GRCm39) Y1262C unknown Het
Usp49 T C 17: 47,985,851 (GRCm39) probably null Het
Vmn1r226 A T 17: 20,908,133 (GRCm39) T122S probably benign Het
Vps8 A T 16: 21,378,087 (GRCm39) T1033S probably benign Het
Vwf C A 6: 125,662,800 (GRCm39) T2728K probably benign Het
Xrn1 C T 9: 95,908,930 (GRCm39) Q1235* probably null Het
Zfp1005 A G 2: 150,110,523 (GRCm39) I404M unknown Het
Other mutations in Wdr5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02394:Wdr5b APN 16 35,862,633 (GRCm39) missense probably damaging 1.00
R0627:Wdr5b UTSW 16 35,862,840 (GRCm39) missense probably benign 0.07
R5280:Wdr5b UTSW 16 35,862,202 (GRCm39) missense probably benign 0.16
R5977:Wdr5b UTSW 16 35,862,374 (GRCm39) missense probably damaging 1.00
R6899:Wdr5b UTSW 16 35,862,150 (GRCm39) missense probably damaging 1.00
R7236:Wdr5b UTSW 16 35,862,208 (GRCm39) missense possibly damaging 0.88
R7246:Wdr5b UTSW 16 35,862,306 (GRCm39) missense probably damaging 1.00
R7641:Wdr5b UTSW 16 35,862,712 (GRCm39) missense probably damaging 1.00
R7918:Wdr5b UTSW 16 35,862,192 (GRCm39) missense probably damaging 0.99
R8063:Wdr5b UTSW 16 35,862,158 (GRCm39) missense possibly damaging 0.78
R8971:Wdr5b UTSW 16 35,861,926 (GRCm39) missense probably benign
Z1088:Wdr5b UTSW 16 35,862,813 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGAGCACAGTCACTTCTCTCTGCC -3'
(R):5'- AGACACTGGAGGGTTGCCTTCATC -3'

Sequencing Primer
(F):5'- AACACTCTATGGTCACAGTCTGG -3'
(R):5'- AGGGTTGCCTTCATCAGCAAG -3'
Posted On 2013-07-11