Incidental Mutation 'PIT4810001:Clasp2'
ID556860
Institutional Source Beutler Lab
Gene Symbol Clasp2
Ensembl Gene ENSMUSG00000033392
Gene NameCLIP associating protein 2
Synonyms1500004F14Rik, CLASP2gamma, CLASP2beta, CLASP2alpha, CLASP2, 8030404L10Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #PIT4810001 (G1)
Quality Score219.009
Status Not validated
Chromosome9
Chromosomal Location113741473-113919682 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 113906067 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 990 (L990Q)
Ref Sequence ENSEMBL: ENSMUSP00000107469 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111838] [ENSMUST00000163895] [ENSMUST00000166734] [ENSMUST00000213663] [ENSMUST00000214522] [ENSMUST00000215022]
Predicted Effect probably damaging
Transcript: ENSMUST00000111838
AA Change: L990Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107469
Gene: ENSMUSG00000033392
AA Change: L990Q

DomainStartEndE-ValueType
TOG 90 323 1.17e-8 SMART
low complexity region 382 395 N/A INTRINSIC
low complexity region 459 472 N/A INTRINSIC
low complexity region 473 484 N/A INTRINSIC
low complexity region 562 572 N/A INTRINSIC
low complexity region 614 634 N/A INTRINSIC
TOG 640 877 2.03e-1 SMART
low complexity region 995 1009 N/A INTRINSIC
TOG 1043 1274 1.49e-24 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000163895
AA Change: L1011Q

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000128460
Gene: ENSMUSG00000033392
AA Change: L1011Q

DomainStartEndE-ValueType
TOG 90 323 1.17e-8 SMART
low complexity region 382 395 N/A INTRINSIC
low complexity region 459 472 N/A INTRINSIC
low complexity region 473 484 N/A INTRINSIC
low complexity region 583 593 N/A INTRINSIC
low complexity region 635 655 N/A INTRINSIC
TOG 661 898 2.03e-1 SMART
low complexity region 1016 1030 N/A INTRINSIC
TOG 1064 1295 1.49e-24 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000166734
AA Change: L991Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130201
Gene: ENSMUSG00000033392
AA Change: L991Q

DomainStartEndE-ValueType
TOG 90 323 1.17e-8 SMART
low complexity region 382 395 N/A INTRINSIC
low complexity region 459 472 N/A INTRINSIC
low complexity region 473 484 N/A INTRINSIC
low complexity region 562 572 N/A INTRINSIC
low complexity region 614 634 N/A INTRINSIC
TOG 640 878 7.51e-1 SMART
low complexity region 996 1010 N/A INTRINSIC
TOG 1044 1275 1.49e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000213663
Predicted Effect probably damaging
Transcript: ENSMUST00000214522
AA Change: L1008Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000215022
Coding Region Coverage
  • 1x: 93.8%
  • 3x: 91.1%
  • 10x: 85.1%
  • 20x: 72.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Targeted deletion of this gene leads to impaired formation of stable microtubules in a wound healing assay, and results in a 2-fold reduction of directionally persistent migration in mutant embryonic fibroblasts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810046K07Rik C T 9: 51,291,692 G54D possibly damaging Het
4932438H23Rik A G 16: 91,055,934 S105P probably damaging Het
Adtrp C T 13: 41,828,248 W48* probably null Het
Agxt2 A T 15: 10,399,065 M413L probably benign Het
Ahnak2 T A 12: 112,785,594 D211V Het
Aplnr T A 2: 85,137,284 C218S probably damaging Het
Arhgdib T A 6: 136,924,164 E189V probably damaging Het
Atp10a T C 7: 58,813,848 I1043T probably damaging Het
Atp13a5 C T 16: 29,314,564 C468Y probably damaging Het
Cars2 A T 8: 11,514,699 C459S probably benign Het
Ccr3 T A 9: 124,029,608 Y327N probably benign Het
Ceacam1 T A 7: 25,471,975 I355F probably damaging Het
Celsr3 T C 9: 108,845,733 L2773P probably damaging Het
Ces2g A T 8: 104,964,889 H192L possibly damaging Het
Cfap157 A G 2: 32,781,432 F121L probably damaging Het
Champ1 G A 8: 13,879,234 S464N probably benign Het
Col6a3 A T 1: 90,778,794 L2806Q unknown Het
Cpz T C 5: 35,508,192 E435G possibly damaging Het
Crbn T A 6: 106,784,479 R233* probably null Het
Ctc1 C T 11: 69,022,526 T116I probably benign Het
Cyp4f17 T C 17: 32,524,600 S314P possibly damaging Het
Dmxl1 A G 18: 49,931,963 E2625G probably damaging Het
Dock7 T A 4: 98,945,559 R1874* probably null Het
E130311K13Rik A T 3: 63,915,701 L174* probably null Het
Etnppl A G 3: 130,620,714 D86G probably benign Het
Fbxw18 C A 9: 109,676,890 E438* probably null Het
Gpatch8 T C 11: 102,481,842 N290S unknown Het
Gpr155 A C 2: 73,348,263 L727R probably benign Het
Gpr158 C G 2: 21,826,871 D927E probably benign Het
Igsf10 T C 3: 59,318,482 Y2590C probably damaging Het
Ints7 A G 1: 191,596,236 D207G probably damaging Het
Iqsec1 A G 6: 90,670,491 L743P probably damaging Het
Kansl1l A T 1: 66,762,149 S553T probably damaging Het
Klhl14 G T 18: 21,557,823 Y523* probably null Het
Krtap14 A G 16: 88,825,627 S155P probably damaging Het
Lrrc3b A G 14: 15,358,273 V111A probably benign Het
Maml2 A G 9: 13,620,024 N178S Het
Megf8 G A 7: 25,342,285 C1208Y probably damaging Het
Mocos A G 18: 24,686,702 D667G probably damaging Het
Nid2 A G 14: 19,810,090 T1359A possibly damaging Het
Nup210 T C 6: 91,030,124 E1357G probably damaging Het
Olfr1239 A T 2: 89,417,953 H153Q probably damaging Het
Olfr1411 T A 1: 92,597,154 F212I probably benign Het
Olfr715 A T 7: 107,128,559 M278K probably benign Het
Pign A G 1: 105,597,762 V447A possibly damaging Het
Pomp T C 5: 147,869,419 L57P probably benign Het
Rbms3 T A 9: 117,056,793 Y128F probably damaging Het
Slc12a4 A G 8: 105,951,596 F322L probably benign Het
Slc16a9 T A 10: 70,283,932 C468* probably null Het
Slc22a18 A G 7: 143,492,931 I271V probably benign Het
Slc25a41 A G 17: 57,039,933 V20A possibly damaging Het
Smim7 A T 8: 72,571,013 L6Q probably damaging Het
Snx29 T C 16: 11,400,981 V227A probably damaging Het
Sowaha A T 11: 53,478,463 L482Q probably damaging Het
Srp19 A G 18: 34,334,470 Y68C probably damaging Het
Tecr A G 8: 83,572,255 S298P probably damaging Het
Terb2 T A 2: 122,204,898 I200N probably damaging Het
Togaram1 G A 12: 64,983,512 S1030N probably damaging Het
Trav7n-4 A G 14: 53,091,736 M68V probably benign Het
Tshz1 A C 18: 84,013,250 L1011R possibly damaging Het
Tubb3 A G 8: 123,421,657 E443G possibly damaging Het
Uba5 A T 9: 104,055,197 I189K probably damaging Het
Vasn A G 16: 4,650,045 T619A probably benign Het
Wbp1l A G 19: 46,654,322 D254G probably benign Het
Zzef1 T C 11: 72,850,745 F738L probably damaging Het
Other mutations in Clasp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00772:Clasp2 APN 9 113905992 splice site probably benign
IGL00885:Clasp2 APN 9 113911416 missense probably damaging 1.00
IGL01314:Clasp2 APN 9 113906127 missense possibly damaging 0.89
IGL01344:Clasp2 APN 9 113813292 splice site probably null
IGL01567:Clasp2 APN 9 113880096 missense probably damaging 1.00
IGL02238:Clasp2 APN 9 113880020 missense probably damaging 1.00
IGL02299:Clasp2 APN 9 113879989 missense probably damaging 1.00
IGL02323:Clasp2 APN 9 113868726 splice site probably benign
IGL02635:Clasp2 APN 9 113908842 missense probably damaging 0.98
IGL02645:Clasp2 APN 9 113890061 missense probably damaging 1.00
IGL02976:Clasp2 APN 9 113906136 missense probably damaging 1.00
IGL03190:Clasp2 APN 9 113844140 nonsense probably null
IGL03219:Clasp2 APN 9 113848477 splice site probably benign
R0067:Clasp2 UTSW 9 113860141 splice site probably benign
R0067:Clasp2 UTSW 9 113860141 splice site probably benign
R0421:Clasp2 UTSW 9 113854302 missense probably benign 0.02
R0432:Clasp2 UTSW 9 113909419 missense probably benign 0.00
R0458:Clasp2 UTSW 9 113906224 intron probably null
R0865:Clasp2 UTSW 9 113911500 missense possibly damaging 0.57
R0972:Clasp2 UTSW 9 113847705 missense possibly damaging 0.58
R1037:Clasp2 UTSW 9 113896634 splice site probably benign
R1925:Clasp2 UTSW 9 113906197 missense possibly damaging 0.88
R2015:Clasp2 UTSW 9 113911500 missense possibly damaging 0.57
R2066:Clasp2 UTSW 9 113906157 missense possibly damaging 0.86
R2330:Clasp2 UTSW 9 113876304 missense probably damaging 1.00
R2568:Clasp2 UTSW 9 113878764 missense probably benign
R3011:Clasp2 UTSW 9 113901513 missense probably damaging 1.00
R3879:Clasp2 UTSW 9 113889961 missense probably damaging 0.98
R3915:Clasp2 UTSW 9 113908737 missense probably damaging 0.99
R3928:Clasp2 UTSW 9 113906105 missense probably benign 0.28
R4323:Clasp2 UTSW 9 113889959 missense possibly damaging 0.91
R4571:Clasp2 UTSW 9 113847721 missense probably damaging 1.00
R4975:Clasp2 UTSW 9 113903916 missense probably damaging 1.00
R5445:Clasp2 UTSW 9 113903946 missense probably damaging 1.00
R5564:Clasp2 UTSW 9 113812768 critical splice donor site probably null
R5697:Clasp2 UTSW 9 113860122 missense probably benign 0.01
R5780:Clasp2 UTSW 9 113850152 missense probably damaging 0.99
R5787:Clasp2 UTSW 9 113862242 missense probably damaging 1.00
R6011:Clasp2 UTSW 9 113876247 missense probably benign 0.07
R6026:Clasp2 UTSW 9 113911578 missense probably benign 0.13
R6090:Clasp2 UTSW 9 113852735 missense probably benign 0.06
R6262:Clasp2 UTSW 9 113876352 critical splice donor site probably null
R6427:Clasp2 UTSW 9 113892444 missense probably damaging 1.00
R6464:Clasp2 UTSW 9 113773717 missense probably damaging 1.00
R6586:Clasp2 UTSW 9 113813264 missense probably damaging 1.00
R6628:Clasp2 UTSW 9 113896720 missense probably damaging 1.00
R6745:Clasp2 UTSW 9 113875270 nonsense probably null
R7032:Clasp2 UTSW 9 113854323 missense probably benign 0.04
R7165:Clasp2 UTSW 9 113786399 intron probably null
R7221:Clasp2 UTSW 9 113852757 missense probably damaging 0.99
R7336:Clasp2 UTSW 9 113876353 splice site probably null
R7583:Clasp2 UTSW 9 113908687 missense probably benign 0.02
X0022:Clasp2 UTSW 9 113852672 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGGGTAGCTCATCTGCTG -3'
(R):5'- GTTTCATGGAACCAGACCTCC -3'

Sequencing Primer
(F):5'- CTGGGAATTGAACTCAGATGCTC -3'
(R):5'- TTTCATGGAACCAGACCTCCAAAATG -3'
Posted On2019-06-07