Incidental Mutation 'PIT4810001:Lrrc3b'
ID556871
Institutional Source Beutler Lab
Gene Symbol Lrrc3b
Ensembl Gene ENSMUSG00000045201
Gene Nameleucine rich repeat containing 3B
SynonymsLRP15
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #PIT4810001 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location15357515-15438987 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 15358273 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 111 (V111A)
Ref Sequence ENSEMBL: ENSMUSP00000059463 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055211] [ENSMUST00000163937] [ENSMUST00000223700]
Predicted Effect probably benign
Transcript: ENSMUST00000055211
AA Change: V111A

PolyPhen 2 Score 0.172 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000059463
Gene: ENSMUSG00000045201
AA Change: V111A

DomainStartEndE-ValueType
LRRNT 33 68 1.85e-8 SMART
LRR 67 86 3e1 SMART
LRR_TYP 87 110 8.94e-3 SMART
LRR 115 135 3.86e0 SMART
Blast:LRRCT 145 196 2e-8 BLAST
transmembrane domain 203 225 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163937
AA Change: V111A

PolyPhen 2 Score 0.172 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000128624
Gene: ENSMUSG00000045201
AA Change: V111A

DomainStartEndE-ValueType
LRRNT 33 68 1.85e-8 SMART
LRR 67 86 3e1 SMART
LRR_TYP 87 110 8.94e-3 SMART
LRR 115 135 3.86e0 SMART
Blast:LRRCT 145 196 2e-8 BLAST
transmembrane domain 203 225 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000223700
AA Change: V111A

PolyPhen 2 Score 0.172 (Sensitivity: 0.92; Specificity: 0.87)
Coding Region Coverage
  • 1x: 93.8%
  • 3x: 91.1%
  • 10x: 85.1%
  • 20x: 72.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a tumor suppressor, with lowered expression levels found in gastric, renal, colorectal, lung, and breast cancer tissues. The promoter of this gene is frequently hypermethylated in these cancer tissues, although the hypermethylation does not appear to be the cause of the reduced expression of this gene. Several transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal olfactory epithelium and bulb. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810046K07Rik C T 9: 51,291,692 G54D possibly damaging Het
4932438H23Rik A G 16: 91,055,934 S105P probably damaging Het
Adtrp C T 13: 41,828,248 W48* probably null Het
Agxt2 A T 15: 10,399,065 M413L probably benign Het
Ahnak2 T A 12: 112,785,594 D211V Het
Aplnr T A 2: 85,137,284 C218S probably damaging Het
Arhgdib T A 6: 136,924,164 E189V probably damaging Het
Atp10a T C 7: 58,813,848 I1043T probably damaging Het
Atp13a5 C T 16: 29,314,564 C468Y probably damaging Het
Cars2 A T 8: 11,514,699 C459S probably benign Het
Ccr3 T A 9: 124,029,608 Y327N probably benign Het
Ceacam1 T A 7: 25,471,975 I355F probably damaging Het
Celsr3 T C 9: 108,845,733 L2773P probably damaging Het
Ces2g A T 8: 104,964,889 H192L possibly damaging Het
Cfap157 A G 2: 32,781,432 F121L probably damaging Het
Champ1 G A 8: 13,879,234 S464N probably benign Het
Clasp2 T A 9: 113,906,067 L990Q probably damaging Het
Col6a3 A T 1: 90,778,794 L2806Q unknown Het
Cpz T C 5: 35,508,192 E435G possibly damaging Het
Crbn T A 6: 106,784,479 R233* probably null Het
Ctc1 C T 11: 69,022,526 T116I probably benign Het
Cyp4f17 T C 17: 32,524,600 S314P possibly damaging Het
Dmxl1 A G 18: 49,931,963 E2625G probably damaging Het
Dock7 T A 4: 98,945,559 R1874* probably null Het
E130311K13Rik A T 3: 63,915,701 L174* probably null Het
Etnppl A G 3: 130,620,714 D86G probably benign Het
Fbxw18 C A 9: 109,676,890 E438* probably null Het
Gpatch8 T C 11: 102,481,842 N290S unknown Het
Gpr155 A C 2: 73,348,263 L727R probably benign Het
Gpr158 C G 2: 21,826,871 D927E probably benign Het
Igsf10 T C 3: 59,318,482 Y2590C probably damaging Het
Ints7 A G 1: 191,596,236 D207G probably damaging Het
Iqsec1 A G 6: 90,670,491 L743P probably damaging Het
Kansl1l A T 1: 66,762,149 S553T probably damaging Het
Klhl14 G T 18: 21,557,823 Y523* probably null Het
Krtap14 A G 16: 88,825,627 S155P probably damaging Het
Maml2 A G 9: 13,620,024 N178S Het
Megf8 G A 7: 25,342,285 C1208Y probably damaging Het
Mocos A G 18: 24,686,702 D667G probably damaging Het
Nid2 A G 14: 19,810,090 T1359A possibly damaging Het
Nup210 T C 6: 91,030,124 E1357G probably damaging Het
Olfr1239 A T 2: 89,417,953 H153Q probably damaging Het
Olfr1411 T A 1: 92,597,154 F212I probably benign Het
Olfr715 A T 7: 107,128,559 M278K probably benign Het
Pign A G 1: 105,597,762 V447A possibly damaging Het
Pomp T C 5: 147,869,419 L57P probably benign Het
Rbms3 T A 9: 117,056,793 Y128F probably damaging Het
Slc12a4 A G 8: 105,951,596 F322L probably benign Het
Slc16a9 T A 10: 70,283,932 C468* probably null Het
Slc22a18 A G 7: 143,492,931 I271V probably benign Het
Slc25a41 A G 17: 57,039,933 V20A possibly damaging Het
Smim7 A T 8: 72,571,013 L6Q probably damaging Het
Snx29 T C 16: 11,400,981 V227A probably damaging Het
Sowaha A T 11: 53,478,463 L482Q probably damaging Het
Srp19 A G 18: 34,334,470 Y68C probably damaging Het
Tecr A G 8: 83,572,255 S298P probably damaging Het
Terb2 T A 2: 122,204,898 I200N probably damaging Het
Togaram1 G A 12: 64,983,512 S1030N probably damaging Het
Trav7n-4 A G 14: 53,091,736 M68V probably benign Het
Tshz1 A C 18: 84,013,250 L1011R possibly damaging Het
Tubb3 A G 8: 123,421,657 E443G possibly damaging Het
Uba5 A T 9: 104,055,197 I189K probably damaging Het
Vasn A G 16: 4,650,045 T619A probably benign Het
Wbp1l A G 19: 46,654,322 D254G probably benign Het
Zzef1 T C 11: 72,850,745 F738L probably damaging Het
Other mutations in Lrrc3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01761:Lrrc3b APN 14 15358098 missense probably benign 0.00
IGL03141:Lrrc3b APN 14 15358390 missense probably damaging 1.00
Klutz UTSW 14 15357946 missense probably damaging 1.00
BB008:Lrrc3b UTSW 14 15358018 missense probably benign 0.36
BB018:Lrrc3b UTSW 14 15358018 missense probably benign 0.36
R0371:Lrrc3b UTSW 14 15358560 nonsense probably null
R1750:Lrrc3b UTSW 14 15358601 missense probably benign 0.00
R2280:Lrrc3b UTSW 14 15358076 missense probably damaging 0.99
R4663:Lrrc3b UTSW 14 15358220 missense probably benign 0.01
R4929:Lrrc3b UTSW 14 15357888 missense probably damaging 1.00
R5344:Lrrc3b UTSW 14 15358591 missense probably damaging 1.00
R6537:Lrrc3b UTSW 14 15357946 missense probably damaging 1.00
R7301:Lrrc3b UTSW 14 15357934 missense probably damaging 1.00
R7931:Lrrc3b UTSW 14 15358018 missense probably benign 0.36
R8113:Lrrc3b UTSW 14 15358232 missense probably benign 0.01
R8220:Lrrc3b UTSW 14 15358004 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCGTGCTCATCCAACACTG -3'
(R):5'- TAAATGTCACCTGTAGCAATGC -3'

Sequencing Primer
(F):5'- TCCAACACTGATGTCTTGCAAATC -3'
(R):5'- TGTCACCTGTAGCAATGCAAATCTC -3'
Posted On2019-06-07