Incidental Mutation 'PIT4810001:Cyp4f17'
ID556880
Institutional Source Beutler Lab
Gene Symbol Cyp4f17
Ensembl Gene ENSMUSG00000091586
Gene Namecytochrome P450, family 4, subfamily f, polypeptide 17
SynonymsEG208285
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #PIT4810001 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location32506462-32528894 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 32524600 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 314 (S314P)
Ref Sequence ENSEMBL: ENSMUSP00000129514 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165999]
Predicted Effect possibly damaging
Transcript: ENSMUST00000165999
AA Change: S314P

PolyPhen 2 Score 0.562 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000129514
Gene: ENSMUSG00000091586
AA Change: S314P

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:p450 52 515 3.5e-135 PFAM
Coding Region Coverage
  • 1x: 93.8%
  • 3x: 91.1%
  • 10x: 85.1%
  • 20x: 72.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810046K07Rik C T 9: 51,291,692 G54D possibly damaging Het
4932438H23Rik A G 16: 91,055,934 S105P probably damaging Het
Adtrp C T 13: 41,828,248 W48* probably null Het
Agxt2 A T 15: 10,399,065 M413L probably benign Het
Ahnak2 T A 12: 112,785,594 D211V Het
Aplnr T A 2: 85,137,284 C218S probably damaging Het
Arhgdib T A 6: 136,924,164 E189V probably damaging Het
Atp10a T C 7: 58,813,848 I1043T probably damaging Het
Atp13a5 C T 16: 29,314,564 C468Y probably damaging Het
Cars2 A T 8: 11,514,699 C459S probably benign Het
Ccr3 T A 9: 124,029,608 Y327N probably benign Het
Ceacam1 T A 7: 25,471,975 I355F probably damaging Het
Celsr3 T C 9: 108,845,733 L2773P probably damaging Het
Ces2g A T 8: 104,964,889 H192L possibly damaging Het
Cfap157 A G 2: 32,781,432 F121L probably damaging Het
Champ1 G A 8: 13,879,234 S464N probably benign Het
Clasp2 T A 9: 113,906,067 L990Q probably damaging Het
Col6a3 A T 1: 90,778,794 L2806Q unknown Het
Cpz T C 5: 35,508,192 E435G possibly damaging Het
Crbn T A 6: 106,784,479 R233* probably null Het
Ctc1 C T 11: 69,022,526 T116I probably benign Het
Dmxl1 A G 18: 49,931,963 E2625G probably damaging Het
Dock7 T A 4: 98,945,559 R1874* probably null Het
E130311K13Rik A T 3: 63,915,701 L174* probably null Het
Etnppl A G 3: 130,620,714 D86G probably benign Het
Fbxw18 C A 9: 109,676,890 E438* probably null Het
Gpatch8 T C 11: 102,481,842 N290S unknown Het
Gpr155 A C 2: 73,348,263 L727R probably benign Het
Gpr158 C G 2: 21,826,871 D927E probably benign Het
Igsf10 T C 3: 59,318,482 Y2590C probably damaging Het
Ints7 A G 1: 191,596,236 D207G probably damaging Het
Iqsec1 A G 6: 90,670,491 L743P probably damaging Het
Kansl1l A T 1: 66,762,149 S553T probably damaging Het
Klhl14 G T 18: 21,557,823 Y523* probably null Het
Krtap14 A G 16: 88,825,627 S155P probably damaging Het
Lrrc3b A G 14: 15,358,273 V111A probably benign Het
Maml2 A G 9: 13,620,024 N178S Het
Megf8 G A 7: 25,342,285 C1208Y probably damaging Het
Mocos A G 18: 24,686,702 D667G probably damaging Het
Nid2 A G 14: 19,810,090 T1359A possibly damaging Het
Nup210 T C 6: 91,030,124 E1357G probably damaging Het
Olfr1239 A T 2: 89,417,953 H153Q probably damaging Het
Olfr1411 T A 1: 92,597,154 F212I probably benign Het
Olfr715 A T 7: 107,128,559 M278K probably benign Het
Pign A G 1: 105,597,762 V447A possibly damaging Het
Pomp T C 5: 147,869,419 L57P probably benign Het
Rbms3 T A 9: 117,056,793 Y128F probably damaging Het
Slc12a4 A G 8: 105,951,596 F322L probably benign Het
Slc16a9 T A 10: 70,283,932 C468* probably null Het
Slc22a18 A G 7: 143,492,931 I271V probably benign Het
Slc25a41 A G 17: 57,039,933 V20A possibly damaging Het
Smim7 A T 8: 72,571,013 L6Q probably damaging Het
Snx29 T C 16: 11,400,981 V227A probably damaging Het
Sowaha A T 11: 53,478,463 L482Q probably damaging Het
Srp19 A G 18: 34,334,470 Y68C probably damaging Het
Tecr A G 8: 83,572,255 S298P probably damaging Het
Terb2 T A 2: 122,204,898 I200N probably damaging Het
Togaram1 G A 12: 64,983,512 S1030N probably damaging Het
Trav7n-4 A G 14: 53,091,736 M68V probably benign Het
Tshz1 A C 18: 84,013,250 L1011R possibly damaging Het
Tubb3 A G 8: 123,421,657 E443G possibly damaging Het
Uba5 A T 9: 104,055,197 I189K probably damaging Het
Vasn A G 16: 4,650,045 T619A probably benign Het
Wbp1l A G 19: 46,654,322 D254G probably benign Het
Zzef1 T C 11: 72,850,745 F738L probably damaging Het
Other mutations in Cyp4f17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00580:Cyp4f17 APN 17 32524875 nonsense probably null
IGL01767:Cyp4f17 APN 17 32506982 missense probably benign
IGL01867:Cyp4f17 APN 17 32528083 missense probably benign 0.30
IGL02009:Cyp4f17 APN 17 32524880 missense probably damaging 1.00
IGL02423:Cyp4f17 APN 17 32506949 missense possibly damaging 0.93
IGL02503:Cyp4f17 APN 17 32524966 critical splice donor site probably null
IGL02571:Cyp4f17 APN 17 32524904 missense probably benign 0.42
IGL03328:Cyp4f17 APN 17 32520626 missense probably damaging 1.00
IGL03047:Cyp4f17 UTSW 17 32524049 missense possibly damaging 0.88
R0486:Cyp4f17 UTSW 17 32524823 splice site probably benign
R0606:Cyp4f17 UTSW 17 32527843 missense probably damaging 0.98
R0655:Cyp4f17 UTSW 17 32524897 missense possibly damaging 0.95
R1781:Cyp4f17 UTSW 17 32524019 missense possibly damaging 0.94
R1795:Cyp4f17 UTSW 17 32517969 missense probably benign 0.00
R1833:Cyp4f17 UTSW 17 32524210 missense probably benign 0.01
R2268:Cyp4f17 UTSW 17 32517954 missense probably benign 0.44
R3030:Cyp4f17 UTSW 17 32506976 missense possibly damaging 0.93
R3861:Cyp4f17 UTSW 17 32528104 missense probably damaging 0.97
R5236:Cyp4f17 UTSW 17 32520632 critical splice donor site probably null
R5450:Cyp4f17 UTSW 17 32528886 missense probably benign
R5866:Cyp4f17 UTSW 17 32506913 missense probably benign 0.03
R5886:Cyp4f17 UTSW 17 32524039 missense possibly damaging 0.78
R5965:Cyp4f17 UTSW 17 32524637 missense probably damaging 0.99
R6692:Cyp4f17 UTSW 17 32506976 missense possibly damaging 0.93
R7056:Cyp4f17 UTSW 17 32527872 missense possibly damaging 0.94
R7968:Cyp4f17 UTSW 17 32524142 missense possibly damaging 0.87
R8458:Cyp4f17 UTSW 17 32520576 missense probably damaging 1.00
R8550:Cyp4f17 UTSW 17 32527962 missense probably benign 0.01
R8818:Cyp4f17 UTSW 17 32524094 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACTCTGTTGAACATTGTATGAAGG -3'
(R):5'- TACGGACAGCTTTAGCACCC -3'

Sequencing Primer
(F):5'- GGATCAAACAACAGGACATTGAC -3'
(R):5'- GGACAGCTTTAGCACCCCAGAG -3'
Posted On2019-06-07