Incidental Mutation 'PIT4812001:Pbx3'
ID556893
Institutional Source Beutler Lab
Gene Symbol Pbx3
Ensembl Gene ENSMUSG00000038718
Gene Namepre B cell leukemia homeobox 3
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #PIT4812001 (G1)
Quality Score155.008
Status Not validated
Chromosome2
Chromosomal Location34171457-34373142 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 34224619 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 101 (E101G)
Ref Sequence ENSEMBL: ENSMUSP00000045281 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040638] [ENSMUST00000113132] [ENSMUST00000127353] [ENSMUST00000138021] [ENSMUST00000141653] [ENSMUST00000143776] [ENSMUST00000153278]
Predicted Effect probably damaging
Transcript: ENSMUST00000040638
AA Change: E101G

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000045281
Gene: ENSMUSG00000038718
AA Change: E101G

DomainStartEndE-ValueType
Pfam:PBC 43 234 2.7e-97 PFAM
HOX 235 300 1.74e-17 SMART
low complexity region 308 341 N/A INTRINSIC
Blast:HOX 342 385 1e-21 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000113132
AA Change: E101G

PolyPhen 2 Score 0.875 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000108757
Gene: ENSMUSG00000038718
AA Change: E101G

DomainStartEndE-ValueType
Pfam:PBC 38 234 8.5e-103 PFAM
HOX 235 300 8.8e-20 SMART
low complexity region 308 336 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000127353
AA Change: E26G

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000114695
Gene: ENSMUSG00000038718
AA Change: E26G

DomainStartEndE-ValueType
Pfam:PBC 1 54 2e-25 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000138021
AA Change: E43G

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000135226
Gene: ENSMUSG00000038718
AA Change: E43G

DomainStartEndE-ValueType
Pfam:PBC 3 128 3.7e-60 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000141653
AA Change: E26G

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000115710
Gene: ENSMUSG00000038718
AA Change: E26G

DomainStartEndE-ValueType
Pfam:PBC 1 96 6.7e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143776
SMART Domains Protein: ENSMUSP00000119914
Gene: ENSMUSG00000038718

DomainStartEndE-ValueType
Pfam:PBC 38 93 4.9e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153278
SMART Domains Protein: ENSMUSP00000123567
Gene: ENSMUSG00000038718

DomainStartEndE-ValueType
Pfam:PBC 38 93 4.9e-26 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000175855
AA Change: E17G

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000135838
Gene: ENSMUSG00000038718
AA Change: E17G

DomainStartEndE-ValueType
Pfam:PBC 1 53 1.6e-27 PFAM
HOX 54 119 8.8e-20 SMART
low complexity region 127 155 N/A INTRINSIC
Coding Region Coverage
  • 1x: 93.8%
  • 3x: 91.0%
  • 10x: 85.3%
  • 20x: 73.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice display neonatal lethality with hypoventilation and respiratory failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik T C 18: 6,630,053 S252P possibly damaging Het
4933409G03Rik G A 2: 68,588,948 V14I probably benign Het
Adgrf5 T G 17: 43,450,369 V985G probably damaging Het
Ankrd44 A T 1: 54,723,038 Y542* probably null Het
Atp13a3 T C 16: 30,362,578 T75A probably damaging Het
Atr T C 9: 95,910,649 F1675L probably benign Het
Atrnl1 A G 19: 57,731,623 I1082V probably benign Het
C87977 A G 4: 144,209,516 I56T probably benign Het
Clip1 T A 5: 123,630,675 R620S probably benign Het
Cped1 T C 6: 22,122,294 F391S probably benign Het
Cracr2a T C 6: 127,625,870 L230P probably damaging Het
Dctn1 T A 6: 83,199,762 V1266E possibly damaging Het
Dlg1 T A 16: 31,846,885 F687I probably benign Het
Dnah8 C A 17: 30,708,445 D1358E probably benign Het
Dnajc11 A G 4: 151,952,889 R84G probably benign Het
Dnajc14 C A 10: 128,806,683 T158N probably damaging Het
Dscc1 A G 15: 55,082,261 L346P probably damaging Het
Efcab3 A G 11: 105,099,979 I71V probably null Het
Erbb3 T A 10: 128,574,379 Q670L possibly damaging Het
Ercc4 G A 16: 13,144,447 E652K probably benign Het
Ercc6l2 T A 13: 63,858,257 V591D possibly damaging Het
Fam126b T G 1: 58,548,703 D117A possibly damaging Het
Fam3c C T 6: 22,321,370 G134E probably damaging Het
Frmd5 A G 2: 121,586,446 V70A probably benign Het
Gjc1 A T 11: 102,800,981 Y65* probably null Het
Gm3033 A C 14: 3,848,891 L137F Het
Gria4 C A 9: 4,427,128 A771S probably damaging Het
Hc A G 2: 35,029,452 L674P probably benign Het
Hjurp CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT C 1: 88,266,277 probably benign Het
Inpp5f A T 7: 128,692,308 Y696F probably benign Het
Itga11 C A 9: 62,732,193 Q157K probably damaging Het
Itgb5 G T 16: 33,919,987 C489F probably damaging Het
Klhl38 C T 15: 58,322,542 G264S probably benign Het
Krt78 C T 15: 101,948,069 V436M probably damaging Het
Mia2 A T 12: 59,101,579 D75V possibly damaging Het
Mphosph6 T A 8: 117,799,149 Q20L probably damaging Het
Ogfr C T 2: 180,595,511 P630S possibly damaging Het
Olfr1206 G A 2: 88,864,970 V122M probably benign Het
Olfr1431 T G 19: 12,210,253 I229S probably damaging Het
Olfr15 A T 16: 3,839,530 K186* probably null Het
Pcca T A 14: 122,790,382 N587K probably benign Het
Pdia3 G T 2: 121,433,530 A287S probably damaging Het
Pfas T A 11: 68,990,036 D209V Het
Pter A T 2: 12,980,368 I170F probably damaging Het
Ptprq A T 10: 107,666,567 V830E probably damaging Het
Rab11fip5 T C 6: 85,341,558 D783G probably benign Het
Rbm19 T C 5: 120,128,250 V446A possibly damaging Het
Selp A G 1: 164,132,263 N363D probably benign Het
Six2 C A 17: 85,685,301 S258I possibly damaging Het
Smc1b A G 15: 85,069,651 V1139A possibly damaging Het
Sp1 A G 15: 102,408,408 T121A possibly damaging Het
Sucla2 A T 14: 73,579,449 I210L possibly damaging Het
Trank1 T C 9: 111,347,912 L339P probably damaging Het
Ttll5 T A 12: 85,926,861 D794E probably benign Het
Usp32 C T 11: 85,010,074 V1107I probably damaging Het
Vmn1r195 T C 13: 22,278,863 Y168H probably benign Het
Vmn1r223 A G 13: 23,249,890 N218S probably damaging Het
Vmn2r25 T A 6: 123,823,488 S632C probably damaging Het
Vwa3a A T 7: 120,776,133 K390I probably damaging Het
Zfp442 A T 2: 150,409,741 C80* probably null Het
Zic1 A T 9: 91,364,341 I226N probably damaging Het
Other mutations in Pbx3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02468:Pbx3 APN 2 34224577 missense probably damaging 1.00
IGL02524:Pbx3 APN 2 34370818 splice site probably benign
R0302:Pbx3 UTSW 2 34224560 missense probably benign 0.42
R1526:Pbx3 UTSW 2 34371764 missense probably damaging 1.00
R1529:Pbx3 UTSW 2 34204859 missense probably damaging 1.00
R1627:Pbx3 UTSW 2 34175953 missense probably benign 0.00
R1652:Pbx3 UTSW 2 34224556 missense probably damaging 1.00
R1791:Pbx3 UTSW 2 34224452 missense possibly damaging 0.95
R1850:Pbx3 UTSW 2 34176820 missense probably benign 0.34
R2908:Pbx3 UTSW 2 34172921 missense probably damaging 0.96
R4073:Pbx3 UTSW 2 34224412 missense probably damaging 1.00
R5212:Pbx3 UTSW 2 34288781 intron probably benign
R5897:Pbx3 UTSW 2 34371908 missense probably benign 0.01
R7376:Pbx3 UTSW 2 34204877 missense probably damaging 0.96
R7504:Pbx3 UTSW 2 34175924 missense probably damaging 0.99
R7812:Pbx3 UTSW 2 34224466 missense probably damaging 1.00
R8079:Pbx3 UTSW 2 34178228 missense probably benign 0.36
Predicted Primers PCR Primer
(F):5'- CTGGGTCAATTTGGCTCTGTAATC -3'
(R):5'- AGTATTAGGGGTCCTAGGATGC -3'

Sequencing Primer
(F):5'- GCTCTGTAATCTGAGTGTTCAATAG -3'
(R):5'- ACAATTCTCATAGCCAAGCTTG -3'
Posted On2019-06-07