Incidental Mutation 'PIT4812001:Olfr1206'
ID556896
Institutional Source Beutler Lab
Gene Symbol Olfr1206
Ensembl Gene ENSMUSG00000062757
Gene Nameolfactory receptor 1206
SynonymsOlfr1207, GA_x6K02T2Q125-50338497-50339264, MOR230-3, GA_x6K02T2Q125-50339974-50340609
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #PIT4812001 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location88863231-88867753 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 88864970 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 122 (V122M)
Ref Sequence ENSEMBL: ENSMUSP00000149929 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077302] [ENSMUST00000216950]
Predicted Effect probably benign
Transcript: ENSMUST00000077302
AA Change: V122M

PolyPhen 2 Score 0.266 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000076532
Gene: ENSMUSG00000062757
AA Change: V122M

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 3.2e-48 PFAM
Pfam:7tm_1 39 285 1.4e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216950
AA Change: V122M

PolyPhen 2 Score 0.266 (Sensitivity: 0.91; Specificity: 0.88)
Coding Region Coverage
  • 1x: 93.8%
  • 3x: 91.0%
  • 10x: 85.3%
  • 20x: 73.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik T C 18: 6,630,053 S252P possibly damaging Het
4933409G03Rik G A 2: 68,588,948 V14I probably benign Het
Adgrf5 T G 17: 43,450,369 V985G probably damaging Het
Ankrd44 A T 1: 54,723,038 Y542* probably null Het
Atp13a3 T C 16: 30,362,578 T75A probably damaging Het
Atr T C 9: 95,910,649 F1675L probably benign Het
Atrnl1 A G 19: 57,731,623 I1082V probably benign Het
C87977 A G 4: 144,209,516 I56T probably benign Het
Clip1 T A 5: 123,630,675 R620S probably benign Het
Cped1 T C 6: 22,122,294 F391S probably benign Het
Cracr2a T C 6: 127,625,870 L230P probably damaging Het
Dctn1 T A 6: 83,199,762 V1266E possibly damaging Het
Dlg1 T A 16: 31,846,885 F687I probably benign Het
Dnah8 C A 17: 30,708,445 D1358E probably benign Het
Dnajc11 A G 4: 151,952,889 R84G probably benign Het
Dnajc14 C A 10: 128,806,683 T158N probably damaging Het
Dscc1 A G 15: 55,082,261 L346P probably damaging Het
Efcab3 A G 11: 105,099,979 I71V probably null Het
Erbb3 T A 10: 128,574,379 Q670L possibly damaging Het
Ercc4 G A 16: 13,144,447 E652K probably benign Het
Ercc6l2 T A 13: 63,858,257 V591D possibly damaging Het
Fam126b T G 1: 58,548,703 D117A possibly damaging Het
Fam3c C T 6: 22,321,370 G134E probably damaging Het
Frmd5 A G 2: 121,586,446 V70A probably benign Het
Gjc1 A T 11: 102,800,981 Y65* probably null Het
Gm3033 A C 14: 3,848,891 L137F Het
Gria4 C A 9: 4,427,128 A771S probably damaging Het
Hc A G 2: 35,029,452 L674P probably benign Het
Hjurp CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT C 1: 88,266,277 probably benign Het
Inpp5f A T 7: 128,692,308 Y696F probably benign Het
Itga11 C A 9: 62,732,193 Q157K probably damaging Het
Itgb5 G T 16: 33,919,987 C489F probably damaging Het
Klhl38 C T 15: 58,322,542 G264S probably benign Het
Krt78 C T 15: 101,948,069 V436M probably damaging Het
Mia2 A T 12: 59,101,579 D75V possibly damaging Het
Mphosph6 T A 8: 117,799,149 Q20L probably damaging Het
Ogfr C T 2: 180,595,511 P630S possibly damaging Het
Olfr1431 T G 19: 12,210,253 I229S probably damaging Het
Olfr15 A T 16: 3,839,530 K186* probably null Het
Pbx3 T C 2: 34,224,619 E101G probably damaging Het
Pcca T A 14: 122,790,382 N587K probably benign Het
Pdia3 G T 2: 121,433,530 A287S probably damaging Het
Pfas T A 11: 68,990,036 D209V Het
Pter A T 2: 12,980,368 I170F probably damaging Het
Ptprq A T 10: 107,666,567 V830E probably damaging Het
Rab11fip5 T C 6: 85,341,558 D783G probably benign Het
Rbm19 T C 5: 120,128,250 V446A possibly damaging Het
Selp A G 1: 164,132,263 N363D probably benign Het
Six2 C A 17: 85,685,301 S258I possibly damaging Het
Smc1b A G 15: 85,069,651 V1139A possibly damaging Het
Sp1 A G 15: 102,408,408 T121A possibly damaging Het
Sucla2 A T 14: 73,579,449 I210L possibly damaging Het
Trank1 T C 9: 111,347,912 L339P probably damaging Het
Ttll5 T A 12: 85,926,861 D794E probably benign Het
Usp32 C T 11: 85,010,074 V1107I probably damaging Het
Vmn1r195 T C 13: 22,278,863 Y168H probably benign Het
Vmn1r223 A G 13: 23,249,890 N218S probably damaging Het
Vmn2r25 T A 6: 123,823,488 S632C probably damaging Het
Vwa3a A T 7: 120,776,133 K390I probably damaging Het
Zfp442 A T 2: 150,409,741 C80* probably null Het
Zic1 A T 9: 91,364,341 I226N probably damaging Het
Other mutations in Olfr1206
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01410:Olfr1206 APN 2 88865520 missense probably benign 0.00
IGL01415:Olfr1206 APN 2 88865520 missense probably benign 0.00
IGL01783:Olfr1206 APN 2 88864842 missense probably damaging 0.98
R0437:Olfr1206 UTSW 2 88864885 missense probably benign 0.01
R0561:Olfr1206 UTSW 2 88864680 missense possibly damaging 0.68
R0669:Olfr1206 UTSW 2 88864928 missense probably benign
R0835:Olfr1206 UTSW 2 88865001 missense probably benign
R0987:Olfr1206 UTSW 2 88865183 missense probably benign 0.00
R1271:Olfr1206 UTSW 2 88865131 nonsense probably null
R1386:Olfr1206 UTSW 2 88865353 missense probably benign 0.14
R1618:Olfr1206 UTSW 2 88865527 splice site probably null
R1935:Olfr1206 UTSW 2 88865180 missense probably benign
R2098:Olfr1206 UTSW 2 88864871 missense probably benign 0.43
R2112:Olfr1206 UTSW 2 88865201 missense possibly damaging 0.67
R2157:Olfr1206 UTSW 2 88864869 missense probably benign
R2912:Olfr1206 UTSW 2 88865114 missense probably benign 0.17
R2913:Olfr1206 UTSW 2 88865114 missense probably benign 0.17
R4583:Olfr1206 UTSW 2 88865494 missense probably benign 0.07
R4631:Olfr1206 UTSW 2 88864830 missense probably benign 0.00
R7707:Olfr1206 UTSW 2 88864809 missense possibly damaging 0.78
R8559:Olfr1206 UTSW 2 88865183 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGGAGTCCCATGTACTTCTTCC -3'
(R):5'- TGTATCCATGCAGGCAAGTTTC -3'

Sequencing Primer
(F):5'- GTTTTATTTGTCCTTTGCTGATTCC -3'
(R):5'- CCATGCAGGCAAGTTTCAATAATGG -3'
Posted On2019-06-07