Incidental Mutation 'PIT4812001:Pdia3'
ID 556897
Institutional Source Beutler Lab
Gene Symbol Pdia3
Ensembl Gene ENSMUSG00000027248
Gene Name protein disulfide isomerase associated 3
Synonyms ERp61, Plca, PDI, Grp58, Erp, PDI-Q2, ERp57, ERp60
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # PIT4812001 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 121413775-121438687 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 121433530 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Serine at position 287 (A287S)
Ref Sequence ENSEMBL: ENSMUSP00000028683 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028683] [ENSMUST00000135079]
AlphaFold P27773
Predicted Effect probably damaging
Transcript: ENSMUST00000028683
AA Change: A287S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000028683
Gene: ENSMUSG00000027248
AA Change: A287S

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Thioredoxin 26 131 5.2e-36 PFAM
Pfam:Thioredoxin_6 160 355 2e-29 PFAM
Pfam:Thioredoxin 377 483 9.5e-33 PFAM
low complexity region 487 503 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135079
SMART Domains Protein: ENSMUSP00000119337
Gene: ENSMUSG00000027248

DomainStartEndE-ValueType
Pfam:Thioredoxin 3 105 5.1e-35 PFAM
Coding Region Coverage
  • 1x: 93.8%
  • 3x: 91.0%
  • 10x: 85.3%
  • 20x: 73.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein of the endoplasmic reticulum that interacts with lectin chaperones calreticulin and calnexin to modulate folding of newly synthesized glycoproteins. The protein was once thought to be a phospholipase; however, it has been demonstrated that the protein actually has protein disulfide isomerase activity. It is thought that complexes of lectins and this protein mediate protein folding by promoting formation of disulfide bonds in their glycoprotein substrates. This protein also functions as a molecular chaperone that prevents the formation of protein aggregates. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for a knock-out allele die by E13.5 with minor changes in ER calcium capacity and unfolded protein response in mouse embryonic fibroblasts. Mice homozygous for a gene trap allele die prior to birth while heterozygous mice exhibit abnormalbone volume bone morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik T C 18: 6,630,053 S252P possibly damaging Het
4933409G03Rik G A 2: 68,588,948 V14I probably benign Het
Adgrf5 T G 17: 43,450,369 V985G probably damaging Het
Ankrd44 A T 1: 54,723,038 Y542* probably null Het
Atp13a3 T C 16: 30,362,578 T75A probably damaging Het
Atr T C 9: 95,910,649 F1675L probably benign Het
Atrnl1 A G 19: 57,731,623 I1082V probably benign Het
C87977 A G 4: 144,209,516 I56T probably benign Het
Clip1 T A 5: 123,630,675 R620S probably benign Het
Cped1 T C 6: 22,122,294 F391S probably benign Het
Cracr2a T C 6: 127,625,870 L230P probably damaging Het
Dctn1 T A 6: 83,199,762 V1266E possibly damaging Het
Dlg1 T A 16: 31,846,885 F687I probably benign Het
Dnah8 C A 17: 30,708,445 D1358E probably benign Het
Dnajc11 A G 4: 151,952,889 R84G probably benign Het
Dnajc14 C A 10: 128,806,683 T158N probably damaging Het
Dscc1 A G 15: 55,082,261 L346P probably damaging Het
Efcab3 A G 11: 105,099,979 I71V probably null Het
Erbb3 T A 10: 128,574,379 Q670L possibly damaging Het
Ercc4 G A 16: 13,144,447 E652K probably benign Het
Ercc6l2 T A 13: 63,858,257 V591D possibly damaging Het
Fam126b T G 1: 58,548,703 D117A possibly damaging Het
Fam3c C T 6: 22,321,370 G134E probably damaging Het
Frmd5 A G 2: 121,586,446 V70A probably benign Het
Gjc1 A T 11: 102,800,981 Y65* probably null Het
Gm3033 A C 14: 3,848,891 L137F Het
Gria4 C A 9: 4,427,128 A771S probably damaging Het
Hc A G 2: 35,029,452 L674P probably benign Het
Hjurp CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT C 1: 88,266,277 probably benign Het
Inpp5f A T 7: 128,692,308 Y696F probably benign Het
Itga11 C A 9: 62,732,193 Q157K probably damaging Het
Itgb5 G T 16: 33,919,987 C489F probably damaging Het
Klhl38 C T 15: 58,322,542 G264S probably benign Het
Krt78 C T 15: 101,948,069 V436M probably damaging Het
Mia2 A T 12: 59,101,579 D75V possibly damaging Het
Mphosph6 T A 8: 117,799,149 Q20L probably damaging Het
Ogfr C T 2: 180,595,511 P630S possibly damaging Het
Olfr1206 G A 2: 88,864,970 V122M probably benign Het
Olfr1431 T G 19: 12,210,253 I229S probably damaging Het
Olfr15 A T 16: 3,839,530 K186* probably null Het
Pbx3 T C 2: 34,224,619 E101G probably damaging Het
Pcca T A 14: 122,790,382 N587K probably benign Het
Pfas T A 11: 68,990,036 D209V Het
Pter A T 2: 12,980,368 I170F probably damaging Het
Ptprq A T 10: 107,666,567 V830E probably damaging Het
Rab11fip5 T C 6: 85,341,558 D783G probably benign Het
Rbm19 T C 5: 120,128,250 V446A possibly damaging Het
Selp A G 1: 164,132,263 N363D probably benign Het
Six2 C A 17: 85,685,301 S258I possibly damaging Het
Smc1b A G 15: 85,069,651 V1139A possibly damaging Het
Sp1 A G 15: 102,408,408 T121A possibly damaging Het
Sucla2 A T 14: 73,579,449 I210L possibly damaging Het
Trank1 T C 9: 111,347,912 L339P probably damaging Het
Ttll5 T A 12: 85,926,861 D794E probably benign Het
Usp32 C T 11: 85,010,074 V1107I probably damaging Het
Vmn1r195 T C 13: 22,278,863 Y168H probably benign Het
Vmn1r223 A G 13: 23,249,890 N218S probably damaging Het
Vmn2r25 T A 6: 123,823,488 S632C probably damaging Het
Vwa3a A T 7: 120,776,133 K390I probably damaging Het
Zfp442 A T 2: 150,409,741 C80* probably null Het
Zic1 A T 9: 91,364,341 I226N probably damaging Het
Other mutations in Pdia3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Pdia3 APN 2 121414178 missense probably damaging 1.00
IGL00777:Pdia3 APN 2 121429556 missense probably damaging 1.00
IGL02020:Pdia3 APN 2 121436419 splice site probably null
IGL02437:Pdia3 APN 2 121433648 missense probably damaging 1.00
IGL02988:Pdia3 UTSW 2 121429556 missense probably damaging 1.00
R0242:Pdia3 UTSW 2 121414111 missense probably damaging 1.00
R0242:Pdia3 UTSW 2 121414111 missense probably damaging 1.00
R0606:Pdia3 UTSW 2 121432377 missense probably damaging 1.00
R0612:Pdia3 UTSW 2 121432377 missense probably damaging 1.00
R0658:Pdia3 UTSW 2 121432377 missense probably damaging 1.00
R0724:Pdia3 UTSW 2 121432377 missense probably damaging 1.00
R0730:Pdia3 UTSW 2 121432377 missense probably damaging 1.00
R0880:Pdia3 UTSW 2 121432377 missense probably damaging 1.00
R0882:Pdia3 UTSW 2 121432377 missense probably damaging 1.00
R1157:Pdia3 UTSW 2 121432377 missense probably damaging 1.00
R1160:Pdia3 UTSW 2 121432377 missense probably damaging 1.00
R1238:Pdia3 UTSW 2 121432377 missense probably damaging 1.00
R1619:Pdia3 UTSW 2 121432377 missense probably damaging 1.00
R1853:Pdia3 UTSW 2 121431663 missense probably benign 0.20
R1854:Pdia3 UTSW 2 121431663 missense probably benign 0.20
R2014:Pdia3 UTSW 2 121434820 missense probably damaging 1.00
R2103:Pdia3 UTSW 2 121433993 missense probably damaging 1.00
R4160:Pdia3 UTSW 2 121414115 missense probably damaging 1.00
R4628:Pdia3 UTSW 2 121414139 missense possibly damaging 0.91
R5032:Pdia3 UTSW 2 121414139 missense probably benign 0.28
R5279:Pdia3 UTSW 2 121414003 unclassified probably benign
R5598:Pdia3 UTSW 2 121414130 missense possibly damaging 0.53
R5815:Pdia3 UTSW 2 121436411 nonsense probably null
R7162:Pdia3 UTSW 2 121429521 missense probably benign 0.00
R7729:Pdia3 UTSW 2 121432357 missense possibly damaging 0.77
X0012:Pdia3 UTSW 2 121435945 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- CCTGCTTCTTGAGTTCAAAGAC -3'
(R):5'- ACGAGAACTCCTCCTGCATG -3'

Sequencing Primer
(F):5'- GTTCAAAGACTTAGCCTAGCCTGG -3'
(R):5'- ATGACAAACTTCTCTCCTTTAGCAG -3'
Posted On 2019-06-07