Incidental Mutation 'PIT4812001:Frmd5'
List |< first << previous [record 24 of 62] next >> last >|
ID556898
Institutional Source Beutler Lab
Gene Symbol Frmd5
Ensembl Gene ENSMUSG00000027238
Gene NameFERM domain containing 5
SynonymsA930004K21Rik, 1500032A09Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #PIT4812001 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location121545529-121807087 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 121586446 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 70 (V70A)
Ref Sequence ENSEMBL: ENSMUSP00000106223 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110592] [ENSMUST00000110593] [ENSMUST00000121219] [ENSMUST00000128428] [ENSMUST00000138157] [ENSMUST00000145075] [ENSMUST00000155570]
Predicted Effect probably benign
Transcript: ENSMUST00000110592
AA Change: V78A

PolyPhen 2 Score 0.104 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000106222
Gene: ENSMUSG00000027238
AA Change: V78A

DomainStartEndE-ValueType
B41 13 210 2.23e-61 SMART
FERM_C 214 302 6.86e-24 SMART
FA 308 354 1.45e-13 SMART
low complexity region 452 474 N/A INTRINSIC
transmembrane domain 501 523 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110593
AA Change: V70A

PolyPhen 2 Score 0.345 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000106223
Gene: ENSMUSG00000027238
AA Change: V70A

DomainStartEndE-ValueType
B41 2 202 4.13e-56 SMART
FERM_C 206 294 6.86e-24 SMART
FA 300 346 1.45e-13 SMART
low complexity region 444 466 N/A INTRINSIC
low complexity region 489 504 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121219
SMART Domains Protein: ENSMUSP00000113568
Gene: ENSMUSG00000027238

DomainStartEndE-ValueType
B41 1 121 1.92e-4 SMART
FERM_C 125 213 6.86e-24 SMART
FA 219 265 1.45e-13 SMART
low complexity region 363 385 N/A INTRINSIC
transmembrane domain 412 434 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128428
AA Change: V78A

PolyPhen 2 Score 0.300 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000116468
Gene: ENSMUSG00000027238
AA Change: V78A

DomainStartEndE-ValueType
B41 13 202 3.21e-44 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000133898
SMART Domains Protein: ENSMUSP00000118269
Gene: ENSMUSG00000027238

DomainStartEndE-ValueType
B41 1 129 8.68e-9 SMART
FERM_C 133 221 6.86e-24 SMART
FA 227 273 1.45e-13 SMART
low complexity region 371 393 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138157
AA Change: V78A

PolyPhen 2 Score 0.228 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000115136
Gene: ENSMUSG00000027238
AA Change: V78A

DomainStartEndE-ValueType
B41 13 210 2.23e-61 SMART
FERM_C 214 302 6.86e-24 SMART
FA 308 354 1.45e-13 SMART
low complexity region 452 474 N/A INTRINSIC
low complexity region 497 512 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145075
SMART Domains Protein: ENSMUSP00000122195
Gene: ENSMUSG00000027238

DomainStartEndE-ValueType
low complexity region 1 16 N/A INTRINSIC
SCOP:d1gg3a3 19 37 6e-5 SMART
low complexity region 71 93 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000155570
AA Change: V70A

PolyPhen 2 Score 0.228 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000120176
Gene: ENSMUSG00000027238
AA Change: V70A

DomainStartEndE-ValueType
B41 2 202 4.13e-56 SMART
FERM_C 206 294 6.86e-24 SMART
FA 300 346 1.45e-13 SMART
low complexity region 444 466 N/A INTRINSIC
Coding Region Coverage
  • 1x: 93.8%
  • 3x: 91.0%
  • 10x: 85.3%
  • 20x: 73.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik T C 18: 6,630,053 S252P possibly damaging Het
4933409G03Rik G A 2: 68,588,948 V14I probably benign Het
Adgrf5 T G 17: 43,450,369 V985G probably damaging Het
Ankrd44 A T 1: 54,723,038 Y542* probably null Het
Atp13a3 T C 16: 30,362,578 T75A probably damaging Het
Atr T C 9: 95,910,649 F1675L probably benign Het
Atrnl1 A G 19: 57,731,623 I1082V probably benign Het
C87977 A G 4: 144,209,516 I56T probably benign Het
Clip1 T A 5: 123,630,675 R620S probably benign Het
Cped1 T C 6: 22,122,294 F391S probably benign Het
Cracr2a T C 6: 127,625,870 L230P probably damaging Het
Dctn1 T A 6: 83,199,762 V1266E possibly damaging Het
Dlg1 T A 16: 31,846,885 F687I probably benign Het
Dnah8 C A 17: 30,708,445 D1358E probably benign Het
Dnajc11 A G 4: 151,952,889 R84G probably benign Het
Dnajc14 C A 10: 128,806,683 T158N probably damaging Het
Dscc1 A G 15: 55,082,261 L346P probably damaging Het
Efcab3 A G 11: 105,099,979 I71V probably null Het
Erbb3 T A 10: 128,574,379 Q670L possibly damaging Het
Ercc4 G A 16: 13,144,447 E652K probably benign Het
Ercc6l2 T A 13: 63,858,257 V591D possibly damaging Het
Fam126b T G 1: 58,548,703 D117A possibly damaging Het
Fam3c C T 6: 22,321,370 G134E probably damaging Het
Gjc1 A T 11: 102,800,981 Y65* probably null Het
Gm3033 A C 14: 3,848,891 L137F Het
Gria4 C A 9: 4,427,128 A771S probably damaging Het
Hc A G 2: 35,029,452 L674P probably benign Het
Hjurp CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT C 1: 88,266,277 probably benign Het
Inpp5f A T 7: 128,692,308 Y696F probably benign Het
Itga11 C A 9: 62,732,193 Q157K probably damaging Het
Itgb5 G T 16: 33,919,987 C489F probably damaging Het
Klhl38 C T 15: 58,322,542 G264S probably benign Het
Krt78 C T 15: 101,948,069 V436M probably damaging Het
Mia2 A T 12: 59,101,579 D75V possibly damaging Het
Mphosph6 T A 8: 117,799,149 Q20L probably damaging Het
Ogfr C T 2: 180,595,511 P630S possibly damaging Het
Olfr1206 G A 2: 88,864,970 V122M probably benign Het
Olfr1431 T G 19: 12,210,253 I229S probably damaging Het
Olfr15 A T 16: 3,839,530 K186* probably null Het
Pbx3 T C 2: 34,224,619 E101G probably damaging Het
Pcca T A 14: 122,790,382 N587K probably benign Het
Pdia3 G T 2: 121,433,530 A287S probably damaging Het
Pfas T A 11: 68,990,036 D209V Het
Pter A T 2: 12,980,368 I170F probably damaging Het
Ptprq A T 10: 107,666,567 V830E probably damaging Het
Rab11fip5 T C 6: 85,341,558 D783G probably benign Het
Rbm19 T C 5: 120,128,250 V446A possibly damaging Het
Selp A G 1: 164,132,263 N363D probably benign Het
Six2 C A 17: 85,685,301 S258I possibly damaging Het
Smc1b A G 15: 85,069,651 V1139A possibly damaging Het
Sp1 A G 15: 102,408,408 T121A possibly damaging Het
Sucla2 A T 14: 73,579,449 I210L possibly damaging Het
Trank1 T C 9: 111,347,912 L339P probably damaging Het
Ttll5 T A 12: 85,926,861 D794E probably benign Het
Usp32 C T 11: 85,010,074 V1107I probably damaging Het
Vmn1r195 T C 13: 22,278,863 Y168H probably benign Het
Vmn1r223 A G 13: 23,249,890 N218S probably damaging Het
Vmn2r25 T A 6: 123,823,488 S632C probably damaging Het
Vwa3a A T 7: 120,776,133 K390I probably damaging Het
Zfp442 A T 2: 150,409,741 C80* probably null Het
Zic1 A T 9: 91,364,341 I226N probably damaging Het
Other mutations in Frmd5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03025:Frmd5 APN 2 121553344 missense probably benign
big_rip UTSW 2 121549218 nonsense probably null
R0385:Frmd5 UTSW 2 121555574 missense probably damaging 1.00
R1667:Frmd5 UTSW 2 121548730 frame shift probably null
R4243:Frmd5 UTSW 2 121562882 splice site probably null
R4590:Frmd5 UTSW 2 121765031 splice site probably null
R4705:Frmd5 UTSW 2 121562863 intron probably benign
R4909:Frmd5 UTSW 2 121591653 splice site probably null
R4935:Frmd5 UTSW 2 121562924 missense possibly damaging 0.75
R5008:Frmd5 UTSW 2 121548860 missense probably damaging 1.00
R5095:Frmd5 UTSW 2 121548921 missense possibly damaging 0.95
R5431:Frmd5 UTSW 2 121562909 missense probably damaging 1.00
R5875:Frmd5 UTSW 2 121558478 intron probably benign
R6246:Frmd5 UTSW 2 121551048 missense possibly damaging 0.66
R6404:Frmd5 UTSW 2 121549218 nonsense probably null
R7039:Frmd5 UTSW 2 121547647 unclassified probably benign
R7072:Frmd5 UTSW 2 121557870 missense probably damaging 0.97
R7520:Frmd5 UTSW 2 121554264 critical splice donor site probably null
R7804:Frmd5 UTSW 2 121591744 missense probably damaging 0.99
R8302:Frmd5 UTSW 2 121547579 missense unknown
Predicted Primers PCR Primer
(F):5'- CCCTCTCAAGATAACTGGGAAC -3'
(R):5'- TAGTTCAGAGCATGGCTTCCC -3'

Sequencing Primer
(F):5'- TGAGGACCCAGGTTCAATTC -3'
(R):5'- AGAGCATGGCTTCCCTCTCTAAAC -3'
Posted On2019-06-07