Incidental Mutation 'PIT4812001:Ogfr'
ID556900
Institutional Source Beutler Lab
Gene Symbol Ogfr
Ensembl Gene ENSMUSG00000049401
Gene Nameopioid growth factor receptor
Synonyms2010013E17Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.476) question?
Stock #PIT4812001 (G1)
Quality Score95.0077
Status Not validated
Chromosome2
Chromosomal Location180589245-180595836 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 180595511 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 630 (P630S)
Ref Sequence ENSEMBL: ENSMUSP00000029087 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029087] [ENSMUST00000103059] [ENSMUST00000132527]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029087
AA Change: P630S

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000029087
Gene: ENSMUSG00000049401
AA Change: P630S

DomainStartEndE-ValueType
low complexity region 7 40 N/A INTRINSIC
Pfam:OGFr_N 76 283 2.3e-111 PFAM
low complexity region 358 369 N/A INTRINSIC
internal_repeat_1 459 483 4.08e-5 PROSPERO
internal_repeat_1 576 600 4.08e-5 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000103059
SMART Domains Protein: ENSMUSP00000099348
Gene: ENSMUSG00000027570

DomainStartEndE-ValueType
Pfam:Collagen 21 80 7.7e-12 PFAM
Pfam:Collagen 58 114 4.2e-9 PFAM
low complexity region 126 162 N/A INTRINSIC
Pfam:Collagen 174 236 4.1e-12 PFAM
Pfam:Collagen 213 292 8e-9 PFAM
internal_repeat_1 315 366 1.58e-12 PROSPERO
internal_repeat_2 360 382 2.94e-6 PROSPERO
low complexity region 384 396 N/A INTRINSIC
Pfam:Collagen 456 518 1.8e-11 PFAM
Pfam:Collagen 545 606 3.8e-11 PFAM
low complexity region 635 656 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132527
SMART Domains Protein: ENSMUSP00000128718
Gene: ENSMUSG00000027570

DomainStartEndE-ValueType
Pfam:Collagen 21 80 7.9e-12 PFAM
Pfam:Collagen 58 114 4.3e-9 PFAM
Pfam:Collagen 109 166 4.5e-8 PFAM
Pfam:Collagen 174 236 4.2e-12 PFAM
Pfam:Collagen 213 292 8.2e-9 PFAM
internal_repeat_1 315 366 1.58e-12 PROSPERO
internal_repeat_2 360 382 2.94e-6 PROSPERO
low complexity region 384 396 N/A INTRINSIC
Pfam:Collagen 402 474 8.2e-8 PFAM
Pfam:Collagen 456 518 1.8e-11 PFAM
Pfam:Collagen 545 606 3.9e-11 PFAM
Pfam:Collagen 603 662 2.5e-8 PFAM
Coding Region Coverage
  • 1x: 93.8%
  • 3x: 91.0%
  • 10x: 85.3%
  • 20x: 73.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a receptor for opioid growth factor (OGF), also known as [Met(5)]-enkephalin. OGF is a negative regulator of cell proliferation and tissue organization in a variety of processes. The encoded unbound receptor for OGF has been localized to the outer nuclear envelope, where it binds OGF and is translocated into the nucleus. The coding sequence of this gene contains a polymorphic region of 60 nt tandem imperfect repeat units. Several transcripts containing between zero and eight repeat units have been reported. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik T C 18: 6,630,053 S252P possibly damaging Het
4933409G03Rik G A 2: 68,588,948 V14I probably benign Het
Adgrf5 T G 17: 43,450,369 V985G probably damaging Het
Ankrd44 A T 1: 54,723,038 Y542* probably null Het
Atp13a3 T C 16: 30,362,578 T75A probably damaging Het
Atr T C 9: 95,910,649 F1675L probably benign Het
Atrnl1 A G 19: 57,731,623 I1082V probably benign Het
C87977 A G 4: 144,209,516 I56T probably benign Het
Clip1 T A 5: 123,630,675 R620S probably benign Het
Cped1 T C 6: 22,122,294 F391S probably benign Het
Cracr2a T C 6: 127,625,870 L230P probably damaging Het
Dctn1 T A 6: 83,199,762 V1266E possibly damaging Het
Dlg1 T A 16: 31,846,885 F687I probably benign Het
Dnah8 C A 17: 30,708,445 D1358E probably benign Het
Dnajc11 A G 4: 151,952,889 R84G probably benign Het
Dnajc14 C A 10: 128,806,683 T158N probably damaging Het
Dscc1 A G 15: 55,082,261 L346P probably damaging Het
Efcab3 A G 11: 105,099,979 I71V probably null Het
Erbb3 T A 10: 128,574,379 Q670L possibly damaging Het
Ercc4 G A 16: 13,144,447 E652K probably benign Het
Ercc6l2 T A 13: 63,858,257 V591D possibly damaging Het
Fam126b T G 1: 58,548,703 D117A possibly damaging Het
Fam3c C T 6: 22,321,370 G134E probably damaging Het
Frmd5 A G 2: 121,586,446 V70A probably benign Het
Gjc1 A T 11: 102,800,981 Y65* probably null Het
Gm3033 A C 14: 3,848,891 L137F Het
Gria4 C A 9: 4,427,128 A771S probably damaging Het
Hc A G 2: 35,029,452 L674P probably benign Het
Hjurp CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT C 1: 88,266,277 probably benign Het
Inpp5f A T 7: 128,692,308 Y696F probably benign Het
Itga11 C A 9: 62,732,193 Q157K probably damaging Het
Itgb5 G T 16: 33,919,987 C489F probably damaging Het
Klhl38 C T 15: 58,322,542 G264S probably benign Het
Krt78 C T 15: 101,948,069 V436M probably damaging Het
Mia2 A T 12: 59,101,579 D75V possibly damaging Het
Mphosph6 T A 8: 117,799,149 Q20L probably damaging Het
Olfr1206 G A 2: 88,864,970 V122M probably benign Het
Olfr1431 T G 19: 12,210,253 I229S probably damaging Het
Olfr15 A T 16: 3,839,530 K186* probably null Het
Pbx3 T C 2: 34,224,619 E101G probably damaging Het
Pcca T A 14: 122,790,382 N587K probably benign Het
Pdia3 G T 2: 121,433,530 A287S probably damaging Het
Pfas T A 11: 68,990,036 D209V Het
Pter A T 2: 12,980,368 I170F probably damaging Het
Ptprq A T 10: 107,666,567 V830E probably damaging Het
Rab11fip5 T C 6: 85,341,558 D783G probably benign Het
Rbm19 T C 5: 120,128,250 V446A possibly damaging Het
Selp A G 1: 164,132,263 N363D probably benign Het
Six2 C A 17: 85,685,301 S258I possibly damaging Het
Smc1b A G 15: 85,069,651 V1139A possibly damaging Het
Sp1 A G 15: 102,408,408 T121A possibly damaging Het
Sucla2 A T 14: 73,579,449 I210L possibly damaging Het
Trank1 T C 9: 111,347,912 L339P probably damaging Het
Ttll5 T A 12: 85,926,861 D794E probably benign Het
Usp32 C T 11: 85,010,074 V1107I probably damaging Het
Vmn1r195 T C 13: 22,278,863 Y168H probably benign Het
Vmn1r223 A G 13: 23,249,890 N218S probably damaging Het
Vmn2r25 T A 6: 123,823,488 S632C probably damaging Het
Vwa3a A T 7: 120,776,133 K390I probably damaging Het
Zfp442 A T 2: 150,409,741 C80* probably null Het
Zic1 A T 9: 91,364,341 I226N probably damaging Het
Other mutations in Ogfr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00480:Ogfr APN 2 180593562 unclassified probably benign
IGL02437:Ogfr APN 2 180589536 missense possibly damaging 0.72
IGL02602:Ogfr APN 2 180595437 missense possibly damaging 0.85
IGL02609:Ogfr APN 2 180592515 splice site probably benign
IGL03297:Ogfr APN 2 180594407 missense possibly damaging 0.93
BB017:Ogfr UTSW 2 180595266 unclassified probably benign
R0085:Ogfr UTSW 2 180591037 splice site probably null
R0398:Ogfr UTSW 2 180593699 missense probably damaging 0.99
R1313:Ogfr UTSW 2 180594630 missense probably benign
R1313:Ogfr UTSW 2 180594630 missense probably benign
R1468:Ogfr UTSW 2 180594750 missense probably damaging 1.00
R1468:Ogfr UTSW 2 180594750 missense probably damaging 1.00
R4747:Ogfr UTSW 2 180594423 missense probably damaging 0.99
R4902:Ogfr UTSW 2 180593725 unclassified probably benign
R5422:Ogfr UTSW 2 180595274 missense possibly damaging 0.63
R5422:Ogfr UTSW 2 180595275 missense probably benign 0.02
R5860:Ogfr UTSW 2 180592492 missense probably damaging 1.00
R5988:Ogfr UTSW 2 180594233 missense probably damaging 1.00
R6015:Ogfr UTSW 2 180594674 missense probably damaging 1.00
R6558:Ogfr UTSW 2 180595404 missense possibly damaging 0.93
R6721:Ogfr UTSW 2 180595428 missense possibly damaging 0.70
R7111:Ogfr UTSW 2 180595266 unclassified probably benign
R7201:Ogfr UTSW 2 180595094 unclassified probably benign
R7217:Ogfr UTSW 2 180595266 unclassified probably benign
R7243:Ogfr UTSW 2 180595266 unclassified probably benign
R7387:Ogfr UTSW 2 180595266 unclassified probably benign
R7563:Ogfr UTSW 2 180592507 critical splice donor site probably null
R7681:Ogfr UTSW 2 180595266 unclassified probably benign
R7844:Ogfr UTSW 2 180595057 unclassified probably benign
R7845:Ogfr UTSW 2 180595266 unclassified probably benign
R7848:Ogfr UTSW 2 180592433 missense probably damaging 1.00
R7930:Ogfr UTSW 2 180595266 unclassified probably benign
R7985:Ogfr UTSW 2 180595057 unclassified probably benign
R8011:Ogfr UTSW 2 180595266 unclassified probably benign
R8039:Ogfr UTSW 2 180595266 unclassified probably benign
R8045:Ogfr UTSW 2 180595057 unclassified probably benign
R8094:Ogfr UTSW 2 180595266 unclassified probably benign
R8339:Ogfr UTSW 2 180595266 unclassified probably benign
RF022:Ogfr UTSW 2 180595266 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- GTGTCCTGAGTCCCAAAAGG -3'
(R):5'- CAGTGAGGTAAGGAGGCTTCTG -3'

Sequencing Primer
(F):5'- CCCCAAAAGCCAGGTGGAG -3'
(R):5'- GCTTCTGAAGGCCTTGGC -3'
Posted On2019-06-07