Incidental Mutation 'PIT4812001:Dnajc11'
ID556902
Institutional Source Beutler Lab
Gene Symbol Dnajc11
Ensembl Gene ENSMUSG00000039768
Gene NameDnaJ heat shock protein family (Hsp40) member C11
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.945) question?
Stock #PIT4812001 (G1)
Quality Score216.009
Status Not validated
Chromosome4
Chromosomal Location151933691-151982137 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 151952889 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 84 (R84G)
Ref Sequence ENSEMBL: ENSMUSP00000051643 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062904] [ENSMUST00000139069] [ENSMUST00000147625]
Predicted Effect probably benign
Transcript: ENSMUST00000062904
AA Change: R84G

PolyPhen 2 Score 0.040 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000051643
Gene: ENSMUSG00000039768
AA Change: R84G

DomainStartEndE-ValueType
DnaJ 13 74 4.41e-24 SMART
low complexity region 102 122 N/A INTRINSIC
Pfam:DUF3395 410 549 2e-50 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000139069
AA Change: R84G

PolyPhen 2 Score 0.629 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000119604
Gene: ENSMUSG00000039768
AA Change: R84G

DomainStartEndE-ValueType
DnaJ 13 74 4.41e-24 SMART
low complexity region 102 122 N/A INTRINSIC
coiled coil region 318 349 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147625
AA Change: R46G

PolyPhen 2 Score 0.040 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000122140
Gene: ENSMUSG00000039768
AA Change: R46G

DomainStartEndE-ValueType
DnaJ 1 36 2.51e-1 SMART
low complexity region 64 84 N/A INTRINSIC
Coding Region Coverage
  • 1x: 93.8%
  • 3x: 91.0%
  • 10x: 85.3%
  • 20x: 73.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU mutation exhibit motor neuron pathology, disorganized cristae and lymphoid abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik T C 18: 6,630,053 S252P possibly damaging Het
4933409G03Rik G A 2: 68,588,948 V14I probably benign Het
Adgrf5 T G 17: 43,450,369 V985G probably damaging Het
Ankrd44 A T 1: 54,723,038 Y542* probably null Het
Atp13a3 T C 16: 30,362,578 T75A probably damaging Het
Atr T C 9: 95,910,649 F1675L probably benign Het
Atrnl1 A G 19: 57,731,623 I1082V probably benign Het
C87977 A G 4: 144,209,516 I56T probably benign Het
Clip1 T A 5: 123,630,675 R620S probably benign Het
Cped1 T C 6: 22,122,294 F391S probably benign Het
Cracr2a T C 6: 127,625,870 L230P probably damaging Het
Dctn1 T A 6: 83,199,762 V1266E possibly damaging Het
Dlg1 T A 16: 31,846,885 F687I probably benign Het
Dnah8 C A 17: 30,708,445 D1358E probably benign Het
Dnajc14 C A 10: 128,806,683 T158N probably damaging Het
Dscc1 A G 15: 55,082,261 L346P probably damaging Het
Efcab3 A G 11: 105,099,979 I71V probably null Het
Erbb3 T A 10: 128,574,379 Q670L possibly damaging Het
Ercc4 G A 16: 13,144,447 E652K probably benign Het
Ercc6l2 T A 13: 63,858,257 V591D possibly damaging Het
Fam126b T G 1: 58,548,703 D117A possibly damaging Het
Fam3c C T 6: 22,321,370 G134E probably damaging Het
Frmd5 A G 2: 121,586,446 V70A probably benign Het
Gjc1 A T 11: 102,800,981 Y65* probably null Het
Gm3033 A C 14: 3,848,891 L137F Het
Gria4 C A 9: 4,427,128 A771S probably damaging Het
Hc A G 2: 35,029,452 L674P probably benign Het
Hjurp CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT C 1: 88,266,277 probably benign Het
Inpp5f A T 7: 128,692,308 Y696F probably benign Het
Itga11 C A 9: 62,732,193 Q157K probably damaging Het
Itgb5 G T 16: 33,919,987 C489F probably damaging Het
Klhl38 C T 15: 58,322,542 G264S probably benign Het
Krt78 C T 15: 101,948,069 V436M probably damaging Het
Mia2 A T 12: 59,101,579 D75V possibly damaging Het
Mphosph6 T A 8: 117,799,149 Q20L probably damaging Het
Ogfr C T 2: 180,595,511 P630S possibly damaging Het
Olfr1206 G A 2: 88,864,970 V122M probably benign Het
Olfr1431 T G 19: 12,210,253 I229S probably damaging Het
Olfr15 A T 16: 3,839,530 K186* probably null Het
Pbx3 T C 2: 34,224,619 E101G probably damaging Het
Pcca T A 14: 122,790,382 N587K probably benign Het
Pdia3 G T 2: 121,433,530 A287S probably damaging Het
Pfas T A 11: 68,990,036 D209V Het
Pter A T 2: 12,980,368 I170F probably damaging Het
Ptprq A T 10: 107,666,567 V830E probably damaging Het
Rab11fip5 T C 6: 85,341,558 D783G probably benign Het
Rbm19 T C 5: 120,128,250 V446A possibly damaging Het
Selp A G 1: 164,132,263 N363D probably benign Het
Six2 C A 17: 85,685,301 S258I possibly damaging Het
Smc1b A G 15: 85,069,651 V1139A possibly damaging Het
Sp1 A G 15: 102,408,408 T121A possibly damaging Het
Sucla2 A T 14: 73,579,449 I210L possibly damaging Het
Trank1 T C 9: 111,347,912 L339P probably damaging Het
Ttll5 T A 12: 85,926,861 D794E probably benign Het
Usp32 C T 11: 85,010,074 V1107I probably damaging Het
Vmn1r195 T C 13: 22,278,863 Y168H probably benign Het
Vmn1r223 A G 13: 23,249,890 N218S probably damaging Het
Vmn2r25 T A 6: 123,823,488 S632C probably damaging Het
Vwa3a A T 7: 120,776,133 K390I probably damaging Het
Zfp442 A T 2: 150,409,741 C80* probably null Het
Zic1 A T 9: 91,364,341 I226N probably damaging Het
Other mutations in Dnajc11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01769:Dnajc11 APN 4 151979302 missense probably damaging 0.99
IGL02253:Dnajc11 APN 4 151950519 nonsense probably null
IGL02606:Dnajc11 APN 4 151979484 missense probably benign 0.18
IGL02969:Dnajc11 APN 4 151978046 missense probably benign 0.33
IGL03062:Dnajc11 APN 4 151970861 missense possibly damaging 0.92
R0601:Dnajc11 UTSW 4 151969936 missense probably damaging 1.00
R0620:Dnajc11 UTSW 4 151973628 missense possibly damaging 0.54
R0639:Dnajc11 UTSW 4 151969936 missense probably damaging 1.00
R1694:Dnajc11 UTSW 4 151979273 missense probably damaging 1.00
R4091:Dnajc11 UTSW 4 151978093 unclassified probably benign
R4545:Dnajc11 UTSW 4 151979941 missense probably damaging 1.00
R4548:Dnajc11 UTSW 4 151973617 missense possibly damaging 0.93
R4720:Dnajc11 UTSW 4 151968539 missense probably damaging 1.00
R4732:Dnajc11 UTSW 4 151970967 unclassified probably benign
R4751:Dnajc11 UTSW 4 151968542 missense probably benign 0.01
R4895:Dnajc11 UTSW 4 151979933 missense probably damaging 1.00
R5122:Dnajc11 UTSW 4 151976997 missense possibly damaging 0.63
R5127:Dnajc11 UTSW 4 151969814 unclassified probably benign
R5174:Dnajc11 UTSW 4 151979984 missense probably damaging 1.00
R5180:Dnajc11 UTSW 4 151969939 missense probably damaging 1.00
R5319:Dnajc11 UTSW 4 151968526 missense probably damaging 1.00
R5624:Dnajc11 UTSW 4 151979510 missense probably benign
R6056:Dnajc11 UTSW 4 151978126 unclassified probably benign
R6434:Dnajc11 UTSW 4 151979294 missense probably damaging 1.00
R7635:Dnajc11 UTSW 4 151968611 missense probably damaging 1.00
R7652:Dnajc11 UTSW 4 151974225 missense probably damaging 0.99
R7937:Dnajc11 UTSW 4 151950452 missense probably damaging 1.00
R7940:Dnajc11 UTSW 4 151968588 missense probably benign 0.00
R8093:Dnajc11 UTSW 4 151969900 missense probably damaging 1.00
R8361:Dnajc11 UTSW 4 151970911 missense probably damaging 0.99
R8684:Dnajc11 UTSW 4 151980726 makesense probably null
Z1176:Dnajc11 UTSW 4 151933783 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGCTTGTCGGACCTATGGGAAG -3'
(R):5'- CTCTCGCTGATGTCTGATGG -3'

Sequencing Primer
(F):5'- AGAACATTTGTCAGAATGCAGC -3'
(R):5'- TGATGTCTGATGGGACCCC -3'
Posted On2019-06-07